NEET Practice
OMR-शैली सराव · NEET UG

प्रश्न बँक

जसे तुम्ही शीटवर करता तसा बबल भरा, मग उत्तर तपासा. भौतिकशास्त्र, रसायनशास्त्र, वनस्पतीशास्त्र आणि प्राणीशास्त्रातील मूळ सराव प्रश्न.

921 प्रश्न

इथे काय आहे

मूळ प्रश्न

चारही विषयांतील सराव प्रश्न — सोडवायला सुरुवात करण्यासाठी साइन इन करा.

मागील वर्षे

वर्षनिहाय खरे मागील NEET परीक्षा पेपर — संग्रह पाहण्यासाठी साइन इन करा.

त्वरित तपासणी

खऱ्या OMR शीटप्रमाणे उत्तर निवडा, मग ते बरोबर आहे का ते पहा.

PHY · PHY-001भौतिकशास्त्र (Physics)
A body of mass 2 kg moving at 3 m/s collides and sticks to a stationary body of mass 4 kg. What is the velocity of the combined mass just after the collision?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-002भौतिकशास्त्र (Physics)
A car accelerates uniformly from rest and reaches 20 m/s in 5 s. What is its acceleration?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-003भौतिकशास्त्र (Physics)
A convex lens has a focal length of 20 cm. What is its power?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-004भौतिकशास्त्र (Physics)
Which physical quantity has the same dimensions as impulse?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-005भौतिकशास्त्र (Physics)
What is the SI unit of electric field strength?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2022-CR6-001भौतिकशास्त्र (Physics)
Two resistors of resistance, 100  and 200  are connected in parallel in an electrical circuit. The ratio of the thermal energy developed in 100  to that in 200  in a given time is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2022-CR6-002भौतिकशास्त्र (Physics)
Two hollow conducting spheres of radii R1 and R2 (R1 >> R2) have equal charges. The potential would be

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2022-CR6-003भौतिकशास्त्र (Physics)
When two monochromatic lights of frequency,  and /2 are incident on a photoelectric metal, their stopping potential becomes Vs/2 and Vs respectively. The threshold frequency for this metal is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2022-CR6-004भौतिकशास्त्र (Physics)
As the temperature increases, the electrical resistance

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2022-CR6-005भौतिकशास्त्र (Physics)
If the initial tension on a stretched string is doubled, then the ratio of the initial and final speeds of a transverse wave along the string is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2022-CR6-006भौतिकशास्त्र (Physics)
Match List-I with List-II: List I — (a) AM radio waves, (b) Microwaves, (c) Infrared radiations, (d) X-rays. List II — (i) 10⁻¹⁰ m, (ii) 10² m, (iii) 10⁻² m, (iv) 10⁻⁴ m. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2022-CR6-007भौतिकशास्त्र (Physics)
The ratio of the radius of gyration of a thin uniform disc about an axis passing through its centre and normal to its plane to the radius of gyration of the disc about its diameter is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2022-CR6-008भौतिकशास्त्र (Physics)
A biconvex lens has radii of curvature, 20 cm each. If the refractive index of the material of the lens is 1.5, the power of the lens is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2022-CR6-010भौतिकशास्त्र (Physics)
When light propagates through a material medium of relative permittivity r and relative permeability r, the velocity of light, v is given by (c-velocity of light in vacuum)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2022-CR6-011भौतिकशास्त्र (Physics)
In the given nuclear reaction, the element X is: ²²₁₁Na → X + e⁺ + ν

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2022-CR6-013भौतिकशास्त्र (Physics)
The ratio of the distances travelled by a freely falling body in the 1st, 2nd, 3rd and 4th second

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2022-CR6-014भौतिकशास्त्र (Physics)
Two objects of mass 10 kg and 20 kg respectively are connected to the two ends of a rigid rod of length 10 m with negligible mass. The distance of the center of mass of the system from the 10 kg mass is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2022-CR6-015भौतिकशास्त्र (Physics)
The energy that will be ideally radiated by a 100 kW transmitter in 1 hour is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2022-CR6-016भौतिकशास्त्र (Physics)
An electric lift with a maximum load of 2000 kg (lift + passengers) is moving up with a constant speed of 1.5 ms⁻¹. The frictional force opposing the motion is 3000 N. The minimum power delivered by the motor to the lift in watts is : (g = 10 m s⁻²)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2022-CR6-017भौतिकशास्त्र (Physics)
A copper wire of length 10 m and radius (10⁻²/π) m has electrical resistance of 10 Ω. The current density in the wire for an electric field strength of 10 (V/m) is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2022-CR6-018भौतिकशास्त्र (Physics)
If a soap bubble expands, the pressure inside the bubble

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2022-CR6-019भौतिकशास्त्र (Physics)
Given below are two statements: Statement I : Biot-Savart’s law gives us the expression for the magnetic field strength of an infinitesimal current element (Idl) of a current carrying conductor only. Statement II : Biot-Savart’s law is analogous to Coulomb’s inverse square law of charge q, with the former being related to the field produced by a scalar source, Idl while the latter being produced by a vector source, q. In light of above statements choose the most appropriate answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2022-CR6-020भौतिकशास्त्र (Physics)
A shell of mass m is at rest initially. It explodes into three fragments having mass in the ratio 2 : 2 : 1. If the fragments having equal mass fly off along mutually perpendicular directions with speed v, the speed of the third (lighter) fragment is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2022-CR6-021भौतिकशास्त्र (Physics)
A spherical ball is dropped in a long column of a highly viscous liquid. The curve in the graph shown, which represents the speed of the ball (v) as a function of time (t) is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2022-CR6-022भौतिकशास्त्र (Physics)
The angular speed of a fly wheel moving with uniform angular acceleration changes from 1200 rpm to 3120 rpm in 16 seconds. The angular acceleration in rad/s² is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2022-CR6-023भौतिकशास्त्र (Physics)
The peak voltage of the ac source is equal to

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2022-CR6-024भौतिकशास्त्र (Physics)
The dimensions [MLT–2A–2] belong to the

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2022-CR6-025भौतिकशास्त्र (Physics)
The displacement-time graphs of two moving particles make angles of 30° and 45° with the x-axis as shown in the figure. The ratio of their respective velocity is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2022-CR6-026भौतिकशास्त्र (Physics)
In the given circuits (a), (b) and (c), the potential drop across the two p-n junctions are equal in

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2022-CR6-027भौतिकशास्त्र (Physics)
The angle between the electric lines of force and the equipotential surface is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2022-CR6-028भौतिकशास्त्र (Physics)
Plane angle and solid angle have

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2022-CR6-029भौतिकशास्त्र (Physics)
In a Young’s double slit experiment, a student observes 8 fringes in a certain segment of screen when a monochromatic light of 600 nm wavelength is used. If the wavelength of light is changed to 400 nm, then the number of fringes he would observe in the same region of the screen is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2022-CR6-030भौतिकशास्त्र (Physics)
A light ray falls on a glass surface of refractive index 3 , at an angle 60°. The angle between the refracted and reflected rays would be

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2022-CR6-031भौतिकशास्त्र (Physics)
In half wave rectification, if the input frequency is 60 Hz, then the output frequency would be

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2022-CR6-032भौतिकशास्त्र (Physics)
A body of mass 60 g experiences a gravitational force of 3.0 N, when placed at a particular point. The magnitude of the gravitational field intensity at that point is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2022-CR6-033भौतिकशास्त्र (Physics)
A square loop of side 1 m and resistance 1 Ω is placed in a magnetic field of 0.5 T. If the plane of loop is perpendicular to the direction of magnetic field, the magnetic flux through the loop is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2022-CR6-034भौतिकशास्त्र (Physics)
Let T1 and T2 be the energy of an electron in the first and second excited states of hydrogen atoms, respectively. According to the Bohr’s model of an atom, the ratio T1 : T2 is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2022-CR6-035भौतिकशास्त्र (Physics)
A long solenoid of radius 1 mm has 100 turns per mm. If 1 A current flows in the solenoid, the magnetic field strength at the centre of the solenoid is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2022-CR6-036भौतिकशास्त्र (Physics)विभाग B
Two pendulums of length 121 cm and 100 cm start vibrating in phase. At some instant, the two are at their mean position in the same phase. The minimum number of vibrations of the shorter pendulum after which the two are again in phase at the mean position is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2022-CR6-037भौतिकशास्त्र (Physics)विभाग B
The volume occupied by the molecules contained in 4.5 kg water at STP, if the intermolecular forces vanish away is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2022-CR6-038भौतिकशास्त्र (Physics)विभाग B
Two transparent media A and B are separated by a plane boundary. The speed of light in those media are 1.5 × 108 m/s and 2.0 × 108 m/s, respectively. The critical angle for a ray of light for these two media is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2022-CR6-039भौतिकशास्त्र (Physics)विभाग B
Match List-I with List-II
List IList II
AGravitational constant (G)I[L²T⁻²]
BGravitational potential energyII[M⁻¹L³T⁻²]
CGravitational potentialIII[LT⁻²]
DGravitational intensityIV[ML²T⁻²]

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2022-CR6-040भौतिकशास्त्र (Physics)विभाग B
A series LCR circuit with inductance 10 H, capacitance 10 µF, resistance 50 Ω is connected to an ac source of voltage, V = 200sin(100t) volt. If the resonant frequency of the LCR circuit is ν₀ and the frequency of the ac source is ν, then

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2022-CR6-041भौतिकशास्त्र (Physics)विभाग B
A ball is projected with a velocity, 10 ms⁻¹, at an angle of 60° with the vertical direction. Its speed at the highest point of its trajectory will be

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2022-CR6-042भौतिकशास्त्र (Physics)विभाग B
From Ampere’s circuital law for a long straight wire of circular cross-section carrying a steady current, the variation of magnetic field in the inside and outside region of the wire is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2022-CR6-043भौतिकशास्त्र (Physics)विभाग B
Given below are two statements : One is labelled as Assertion (A) and the other is labelled as Reason (R). Assertion (A): The stretching of a spring is determined by the shear modulus of the material of the spring. Reason (R): A coil spring of copper has more tensile strength than a steel spring of same dimensions. In the light of the above statements, choose the most appropriate answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2022-CR6-045भौतिकशास्त्र (Physics)विभाग B
A nucleus of mass number 189 splits into two nuclei having mass number 125 and 64. The ratio of radius of two daughter nuclei respectively is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2022-CR6-046भौतिकशास्त्र (Physics)विभाग B
A wheatstone bridge is used to determine the value of unknown resistance X by adjusting the variable resistance Y as shown in the figure. For the most precise measurement of X, the resistances P and Q

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2022-CR6-047भौतिकशास्त्र (Physics)विभाग B
The area of a rectangular field (in m2) of length 55.3 m and breadth 25 m after rounding off the value for correct significant digits is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2022-CR6-048भौतिकशास्त्र (Physics)विभाग B
A big circular coil of 1000 turns and average radius 10 m is rotating about its horizontal diameter at 2 rad s–1. If the vertical component of earth’s magnetic field at that place is 2 × 10–5 T and electrical resistance of the coil is 12.56 Ω, then the maximum induced current in the coil will be

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2022-CR6-049भौतिकशास्त्र (Physics)विभाग B
Two point charges –q and +q are placed at a distance of L, as shown in the figure. The magnitude of electric field intensity at a distance R(R >> L) varies as

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2023-CG3-001भौतिकशास्त्र (Physics)
Two bodies of mass m and 9m are placed at a distance R. The gravitational potential on the line joining the bodies where the gravitational field equals zero, will be (G = gravitational constant)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2023-CG3-002भौतिकशास्त्र (Physics)
In hydrogen spectrum, the shortest wavelength in the Balmer series is λ. The shortest wavelength in the Bracket series is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2023-CG3-003भौतिकशास्त्र (Physics)
Light travels a distance x in time t₁ in air and 10x in time t₂ in another denser medium. What is the critical angle for this medium?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2023-CG3-004भौतिकशास्त्र (Physics)
The magnetic energy stored in an inductor of inductance 4 µH carrying a current of 2 A is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2023-CG3-005भौतिकशास्त्र (Physics)
The amount of energy required to form a soap bubble of radius 2 cm from a soap solution is nearly (surface tension of soap solution = 0.03 N m⁻¹)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2023-CG3-006भौतिकशास्त्र (Physics)
The potential energy of a long spring when stretched by 2 cm is U. If the spring is stretched by 8 cm, potential energy stored in it will be

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2023-CG3-007भौतिकशास्त्र (Physics)
A football player is moving southward and suddenly turns eastward with the same speed to avoid an opponent. The force that acts on the player while turning is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2023-CG3-008भौतिकशास्त्र (Physics)
The ratio of frequencies of fundamental harmonic produced by an open pipe to that of closed pipe having the same length is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2023-CG3-009भौतिकशास्त्र (Physics)
The magnitude and direction of the current in the following circuit is (figure-dependent: bridge-style circuit with nodes A, B, C, D and cell E in the middle branch; resistors 2Ω between A and E-junction, 1Ω between E-junction and B, 7Ω between D and C, cell E with 10V and 5V cells in series in the top branch — not transcribable as text)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2023-CG3-010भौतिकशास्त्र (Physics)
An ac source is connected to a capacitor C. Due to decrease in its operating frequency

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2023-CG3-011भौतिकशास्त्र (Physics)
The errors in the measurement which arise due to unpredictable fluctuations in temperature and voltage supply are

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2023-CG3-012भौतिकशास्त्र (Physics)
The angular acceleration of a body, moving along the circumference of a circle, is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2023-CG3-013भौतिकशास्त्र (Physics)
A vehicle travels half the distance with speed v and the remaining distance with speed 2v. Its average speed is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2023-CG3-014भौतिकशास्त्र (Physics)
If the galvanometer G does not show any deflection in the circuit shown, the value of R is given by (figure-dependent: circuit with a 10V cell and 400Ω resistor in one branch, a 2V cell in another branch, both meeting at a node connected through galvanometer G, with variable resistor R between the node and the bottom rail — not transcribable as text)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2023-CG3-015भौतिकशास्त्र (Physics)
Resistance of a carbon resistor determined from colour codes is (22000 ± 5%) Ω. The colour of third band must be

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2023-CG3-016भौतिकशास्त्र (Physics)
A Carnot engine has an efficiency of 50% when its source is at a temperature 327°C. The temperature of the sink is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2023-CG3-017भौतिकशास्त्र (Physics)
The net magnetic flux through any closed surface is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2023-CG3-018भौतिकशास्त्र (Physics)
A full wave rectifier circuit consists of two p-n junction diodes, a centre-tapped transformer, capacitor and a load resistance. Which of these components remove the ac ripple from the rectified output?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2023-CG3-019भौतिकशास्त्र (Physics)
The minimum wavelength of X-rays produced by an electron accelerated through a potential difference of V volts is proportional to

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2023-CG3-020भौतिकशास्त्र (Physics)
The temperature of a gas is −50°C. To what temperature the gas should be heated so that the rms speed is increased by 3 times?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2023-CG3-021भौतिकशास्त्र (Physics)
In a series LCR circuit, the inductance L is 10 mH, capacitance C is 1 µF and resistance R is 100 Ω. The frequency at which resonance occurs is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2023-CG3-022भौतिकशास्त्र (Physics)
A 12 V, 60 W lamp is connected to the secondary of a step-down transformer, whose primary is connected to ac mains of 220 V. Assuming the transformer to be ideal, what is the current in the primary winding?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2023-CG3-023भौतिकशास्त्र (Physics)
The work functions of Caesium (Cs), Potassium (K) and Sodium (Na) are 2.14 eV, 2.30 eV and 2.75 eV respectively. If incident electromagnetic radiation has an incident energy of 2.20 eV, which of these photosensitive surfaces may emit photoelectrons?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2023-CG3-024भौतिकशास्त्र (Physics)
An electric dipole is placed at an angle of 30° with an electric field of intensity 2 × 10⁵ N C⁻¹. It experiences a torque equal to 4 N m. Calculate the magnitude of charge on the dipole, if the dipole length is 2 cm.

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2023-CG3-025भौतिकशास्त्र (Physics)
In a plane electromagnetic wave travelling in free space, the electric field component oscillates sinusoidally at a frequency of 2.0 × 10¹⁰ Hz and amplitude 48 V m⁻¹. Then the amplitude of oscillating magnetic field is (Speed of light in free space = 3 × 10⁸ m s⁻¹)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2023-CG3-026भौतिकशास्त्र (Physics)
A metal wire has mass (0.4 ± 0.002) g, radius (0.3 ± 0.001) mm and length (5 ± 0.02) cm. The maximum possible percentage error in the measurement of density will nearly be

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2023-CG3-027भौतिकशास्त्र (Physics)
The half life of a radioactive substance is 20 minutes. In how much time, the activity of substance drops to (1/16)th of its initial value?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2023-CG3-028भौतिकशास्त्र (Physics)
The ratio of radius of gyration of a solid sphere of mass M and radius R about its own axis to the radius of gyration of the thin hollow sphere of same mass and radius about its axis is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2023-CG3-029भौतिकशास्त्र (Physics)
The equivalent capacitance of the system shown in the following circuit is (figure-dependent: one 3 µF capacitor in series between A and a junction, then two 3 µF capacitors in parallel between that junction and B — not transcribable as text)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2023-CG3-030भौतिकशास्त्र (Physics)
For Young's double slit experiment, two statements are given below: Statement I: If screen is moved away from the plane of slits, angular separation of the fringes remains constant. Statement II: If the monochromatic source is replaced by another monochromatic source of larger wavelength, the angular separation of fringes decreases. In the light of the above statements, choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2023-CG3-031भौतिकशास्त्र (Physics)
A bullet is fired from a gun at the speed of 280 m s⁻¹ in the direction 30° above the horizontal. The maximum height attained by the bullet is (g = 9.8 m s⁻², sin30° = 0.5)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2023-CG3-032भौतिकशास्त्र (Physics)
Given below are two statements: Statement I: Photovoltaic devices can convert optical radiation into electricity. Statement II: Zener diode is designed to operate under reverse bias in breakdown region. In the light of the above statements, choose the most appropriate answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2023-CG3-033भौतिकशास्त्र (Physics)
The venturi-meter works on

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2023-CG3-034भौतिकशास्त्र (Physics)
If ∮E·dS = 0 over a surface, then

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2023-CG3-035भौतिकशास्त्र (Physics)
Let a wire be suspended from the ceiling (rigid support) and stretched by a weight W attached at its free end. The longitudinal stress at any point of cross-sectional area A of the wire is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2023-CG3-036भौतिकशास्त्र (Physics)विभाग B
A bullet from a gun is fired on a rectangular wooden block with velocity u. When bullet travels 24 cm through the block along its length horizontally, velocity of bullet becomes u/3. Then it further penetrates into the block in the same direction before coming to rest exactly at the other end of the block. The total length of the block is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2023-CG3-037भौतिकशास्त्र (Physics)विभाग B
A horizontal bridge is built across a river. A student standing on the bridge throws a small ball vertically upwards with a velocity 4 m s⁻¹. The ball strikes the water surface after 4 s. The height of bridge above water surface is (Take g = 10 m s⁻²)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2023-CG3-038भौतिकशास्त्र (Physics)विभाग B
A very long conducting wire is bent in a semi-circular shape from A to B as shown in figure. The magnetic field at point P for steady current configuration is given by (figure-dependent: straight wire carrying current i into point A, semicircular arc of radius R from A to B with center P, then straight wire carrying current i away from point B — not transcribable as text)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2023-CG3-039भौतिकशास्त्र (Physics)विभाग B
The net impedance of circuit (as shown in figure) will be (figure-dependent: series circuit with inductor 50/π mH, capacitor 10³/π µF, and resistor 10Ω connected to a 220V, 50Hz ac source — not transcribable as text)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2023-CG3-040भौतिकशास्त्र (Physics)विभाग B
The radius of inner most orbit of hydrogen atom is 5.3 × 10⁻¹¹ m. What is the radius of third allowed orbit of hydrogen atom?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2023-CG3-041भौतिकशास्त्र (Physics)विभाग B
A satellite is orbiting just above the surface of the earth with period T. If d is the density of the earth and G is the universal constant of gravitation, the quantity 3π/Gd represents

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2023-CG3-042भौतिकशास्त्र (Physics)विभाग B
The resistance of platinum wire at 0°C is 2 Ω and 6.8 Ω at 80°C. The temperature coefficient of resistance of the wire is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2023-CG3-043भौतिकशास्त्र (Physics)विभाग B
Calculate the maximum acceleration of a moving car so that a body lying on the floor of the car remains stationary. The coefficient of static friction between the body and the floor is 0.15 (g = 10 m s⁻²).

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2023-CG3-044भौतिकशास्त्र (Physics)विभाग B
10 resistors, each of resistance R are connected in series to a battery of emf E and negligible internal resistance. Then those are connected in parallel to the same battery, the current is increased n times. The value of n is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2023-CG3-045भौतिकशास्त्र (Physics)विभाग B
In the figure shown here, what is the equivalent focal length of the combination of lenses (Assume that all layers are thin)? (figure-dependent: plano-convex-plano lens stack with refractive indices n₁=1.5 (outer layers) and n₂=1.6 (middle lens), R₁=R₂=20 cm — not transcribable as text)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2023-CG3-046भौतिकशास्त्र (Physics)विभाग B
Two thin lenses are of same focal lengths (f), but one is convex and the other one is concave. When they are placed in contact with each other, the equivalent focal length of the combination will be

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2023-CG3-047भौतिकशास्त्र (Physics)विभाग B
The x-t graph of a particle performing simple harmonic motion is shown in the figure. The acceleration of the particle at t = 2 s is (figure-dependent: x-t sinusoidal graph, amplitude 1 m, period 8 s, curve starts at 0, peaks at t=2, crosses zero at t=4, troughs at t=6, back to zero at t=8 — not transcribable as text)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2023-CG3-048भौतिकशास्त्र (Physics)विभाग B
An electric dipole is placed as shown in the figure (figure-dependent: charges −q and +q separated by 3 cm each side of center O, point P is 5 cm further along the axis from +q — not transcribable as text). The electric potential (in 10² V) at point P due to the dipole is (ε₀ = permittivity of free space and 1/(4πε₀) = K)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2023-CG3-049भौतिकशास्त्र (Physics)विभाग B
For the following logic circuit, the truth table is (figure-dependent: inputs A and B each pass through a NOT gate, then both feed into a NAND gate to produce output Y — not transcribable as text)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2023-CG3-050भौतिकशास्त्र (Physics)विभाग B
A wire carrying a current I along the positive x-axis has length L. It is kept in a magnetic field B = (2î + 3ĵ − 4k̂) T. The magnitude of the magnetic force acting on the wire is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2024-CT3-001भौतिकशास्त्र (Physics)
A tightly wound 100 turns coil of radius 10 cm carries a current of 7 A. The magnitude of the magnetic field at the centre of the coil is (Take permeability of free space as 4π × 10⁻⁷ SI units)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2024-CT3-002भौतिकशास्त्र (Physics)
Match List-I with List-II
List IList II
ADiamagneticIx = 0
BFerromagneticII0 ≥ x ≥ −1
CParamagneticIIIx ≫ 1
DNon-magneticIV0 < x < ε (a small positive number)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2024-CT3-003भौतिकशास्त्र (Physics)
A thermodynamic system is taken through the cycle abcda. The work done by the gas along the path bc is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2024-CT3-004भौतिकशास्त्र (Physics)
An unpolarised light beam strikes a glass surface at Brewster’s angle. Then

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2024-CT3-005भौतिकशास्त्र (Physics)
In an ideal transformer, the turns ratio = Np/Ns = 1/2. The ratio Vs : Vp is equal to (the symbols carry their usual meaning)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2024-CT3-006भौतिकशास्त्र (Physics)
A logic circuit provides the output Y as per the following truth table: A B Y 0 0 1 0 1 0 1 0 1 1 1 0.

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2024-CT3-007भौतिकशास्त्र (Physics)
In a vernier calipers, (N + 1) divisions of vernier scale coincide with N divisions of main scale. If 1 MSD represents 0.1 mm, the vernier constant (in cm) is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2024-CT3-008भौतिकशास्त्र (Physics)
The maximum elongation of a steel wire of 1 m length if the elastic limit of steel and its Young’s modulus, respectively, are 8 × 10⁸ N m⁻² and 2 × 10¹¹ N m⁻², is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2024-CT3-010भौतिकशास्त्र (Physics)
If the monochromatic source in Young’s double slit experiment is replaced by white light, then

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2024-CT3-011भौतिकशास्त्र (Physics)
The graph which shows the variation of (1/λ²) and its kinetic energy, E is (where λ is de Broglie wavelength of a free particle)
  • A
  • B
  • C
  • D
उत्तर की प्रलंबित — केवळ संदर्भासाठी, गुण दिले जाणार नाहीत

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2024-CT3-014भौतिकशास्त्र (Physics)
Consider the following statements A and B and identify the correct answer : A. For a solar-cell, the I-V characteristics lies in the IV quadrant of the given graph. B. In a reverse biased pn junction diode, the current measured in (µA), is due to majority charge carriers.

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2024-CT3-016भौतिकशास्त्र (Physics)
Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R. Assertion A: The potential (V) at any axial point, at 2 m distance (r) from the centre of the dipole of dipole moment vector P of magnitude, 4 × 10⁻⁶ C m, is ±9 × 10³ V. (Take 1/(4πε₀) = 9 × 10⁹ SI units) Reason R: V = ±(2P)/(4πε₀r²), where r is the distance of any axial point, situated at 2 m from the centre of the dipole. In the light of the above statements, choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2024-CT3-017भौतिकशास्त्र (Physics)
The moment of inertia of a thin rod about an axis passing through its mid point and perpendicular to the rod, is 2400 g cm². The length of the 400 g rod is nearly

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2024-CT3-018भौतिकशास्त्र (Physics)
The terminal voltage of the battery, whose emf is 10 V and internal resistance 1 Ω, when connected through an external resistance of 4 Ω as shown in the figure is : (figure-dependent: circuit diagram showing a battery of emf 10 V and internal resistance 1 Ω connected to an external resistor of 4 Ω — not transcribable as text)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2024-CT3-019भौतिकशास्त्र (Physics)
Match the List-I with List-II
List IList II
An₂ = 3 to n₁ = 2I410.2
Bn₂ = 4 to n₁ = 2II434.1
Cn₂ = 5 to n₁ = 2III656.3
Dn₂ = 6 to n₁ = 2IV486.1 (wavelengths in nm)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2024-CT3-020भौतिकशास्त्र (Physics)
If c is the velocity of light in free space, the correct statements about photon among the following are : A. The energy of a photon is E = hν. B. The velocity of a photon is c. C. The momentum of a photon, p = hν/c. D. In a photon-electron collision, both total energy and total momentum are conserved. E. Photon possesses positive charge. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2024-CT3-021भौतिकशास्त्र (Physics)
In the nuclear emission stated above, the mass number and atomic number of the product Q respectively, are

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2024-CT3-022भौतिकशास्त्र (Physics)
At any instant of time t, the displacement of any particle is given by 2t − 1 (SI unit) under the influence of force of 5N. The value of instantaneous power is (in SI unit)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2024-CT3-023भौतिकशास्त्र (Physics)
The output (Y) of the given logic gate is similar to the output of an/a : (figure-dependent: logic gate circuit diagram — not transcribable as text)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2024-CT3-024भौतिकशास्त्र (Physics)
The mass of a planet is 1/10 th that of the earth and its diameter is half that of the earth. The acceleration due to gravity on that planet is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2024-CT3-025भौतिकशास्त्र (Physics)
Given below are two statements : Statement I: Atoms are electrically neutral as they contain equal number of positive and negative charges. Statement II: Atoms of each element are stable and emit their characteristic spectrum. In the fight of the above statements, choose the most appropriate answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2024-CT3-026भौतिकशास्त्र (Physics)
A wheel of a bullock cart is rolling on a level road as shows in the figure below. If its linear speed is v in the direction shown, which one of the following options is correct (P and Q are any highest and lowest points on the wheel respectively)? (figure-dependent: rolling wheel diagram with labeled top point P and bottom point Q — not transcribable as text)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2024-CT3-027भौतिकशास्त्र (Physics)
A particle moving with uniform speed in a circular path maintains;

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2024-CT3-028भौतिकशास्त्र (Physics)
A thin flat circular disc of radius 4.5 cm is placed gently over the surface of water. If surface tension of water is 0.07 Nm⁻¹, then the excess force required to take it away from the surface is;

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2024-CT3-029भौतिकशास्त्र (Physics)
In a uniform magnetic field of 0.049 T, a magnetic needle performs 20 complete oscillations in 5 seconds as shown. The moment of inertia of the needle is 9.8 × 10⁻⁶ kg m². If the magnitude of magnetic moment of the needle is x × 10⁻⁵ Am², then the value of ‘x’ is; (figure-dependent: oscillating magnetic needle diagram — not transcribable as text)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2024-CT3-030भौतिकशास्त्र (Physics)
Two bodies A and B of same mass undergo completely inelastic one dimensional collision. The body A moves with velocity v₁ while body B is at rest before collision. The velocity of the system after collision is v₂. The ratio v₁ : v₂ is;

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2024-CT3-031भौतिकशास्त्र (Physics)
If x = 5sin(πt + π/3) m represents the motion of a particle executing simple harmonic motion, the amplitude and time period of motion, respectively, are;

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2024-CT3-032भौतिकशास्त्र (Physics)
The quantities which have the same dimensions as those of solid angle are;

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2024-CT3-033भौतिकशास्त्र (Physics)
A thin spherical shell is charged by some source. The potential difference between the two points C and P (in V) shown in the figure is; (figure-dependent: charged spherical shell with points C (on surface) and P (inside) marked — not transcribable as text)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2024-CT3-034भौतिकशास्त्र (Physics)
A bob is whirled in a horizontal plane by means of a string with an initial speed of ω rpm. The tension in the string is T. If speed becomes 2 ω while keeping the same radius, the tension in the string becomes;

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2024-CT3-035भौतिकशास्त्र (Physics)
A wire of length ‘l’ and resistance 100 Ω is divided into 10 equal parts. The first 5 parts are connected in series while the next 5 parts are connected in parallel. The two combinations are again connected in series. The resistance of this final combination is;

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2024-CT3-036भौतिकशास्त्र (Physics)विभाग B
The following graph represents the T-V curves of an ideal gas (where T is the temperature and V the volume) at three pressures P1, P2 and P3 compared with those of Charles’s law represented as dotted lines.

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2024-CT3-037भौतिकशास्त्र (Physics)विभाग B
A parallel plate capacitor is charged by connecting it to a battery through a resistor. If I is the current in the circuit, then in the gap between the plates;

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2024-CT3-038भौतिकशास्त्र (Physics)विभाग B
The property which is not of an electromagnetic wave travelling in free space is that;

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2024-CT3-040भौतिकशास्त्र (Physics)विभाग B
If the plates of a parallel plate capacitor connected to a battery are moved close to each other, then A. the charge stored in it, increase. B. the energy stored in it, decreases. C. its capacitance increases. D. the ratio of charge to its potential remains the same. E. the product of charge and voltage increases. Choose the most appropriate answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2024-CT3-041भौतिकशास्त्र (Physics)विभाग B
A force defined by F = αt² + βt acts on a particle at a given time t. The factor which is dimensionless, if α and β are constants, is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2024-CT3-042भौतिकशास्त्र (Physics)विभाग B
A metallic bar of Young’s modulus, 0.5 ×10¹¹ N m⁻² and coefficient of linear thermal expansion 10⁻⁵ °C⁻¹, length 1 m and area of cross-section 10⁻³ m² is heated from 0°C to 100°C without expansion or bending. The compressive force developed in it is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2024-CT3-043भौतिकशास्त्र (Physics)विभाग B
A small telescope has an objective of focal length 140 cm and an eye piece of focal length 5.0 cm. The magnifying power of telescope for viewing a distant object is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2024-CT3-044भौतिकशास्त्र (Physics)विभाग B
An iron bar of length L has magnetic moment M. It is bent at the middle of its length such that the two arms make an angle 60° with each other. The magnetic moment of this new magnet is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2024-CT3-046भौतिकशास्त्र (Physics)विभाग B
Two heaters A and B have power rating of 1 kW and 2kW, respectively. Those two are first connected in series and then in parallel to a fixed power source. The ratio of power outputs for these two cases is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2024-CT3-048भौतिकशास्त्र (Physics)विभाग B
If the mass of the bob in simple pendulum is increased to thrice its original mass and its length is made half its original length, then the new time period of oscillation is x/2 times its original time period. Then the value of x is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2024-CT3-049भौतिकशास्त्र (Physics)विभाग B
The minimum energy required to launch a satellite of mass m from the surface of earth of mass M and radius R in a circular orbit at an altitude of 2R from the surface of the earth is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2024-CT3-050भौतिकशास्त्र (Physics)विभाग B
A sheet is placed on a horizontal surface in front of a strong magnetic pole. A force is needed to: A. hold the sheet there if it is magnetic. B. hold the sheet there if it non–magnetic. C. move the sheet away from the pole with uniform velocity if it is conducting. D. move the sheet away from the pole with uniform velocity if it is both, non-conducting and non-polar. Choose the correct statement(s) from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2025-C45-002भौतिकशास्त्र (Physics)
A microscope has an objective of focal length 2 cm, eyepiece of focal length 4 cm and the tube length of 40 cm. If the distance of distinct vision of eye is 25 cm, the magnification in the microscope is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2025-C45-003भौतिकशास्त्र (Physics)
An electron (mass 9 × 10⁻³¹ kg and charge 1.6 × 10⁻¹⁹ C) moving with speed c/100 (c = speed of light) is injected into a magnetic field B of magnitude 9 × 10⁻⁴ T perpendicular to its direction of motion. We wish to apply a uniform electric E together with the magnetic field so that the electron does not deflect from its path. Then (speed of light c = 3 × 10⁸ ms⁻¹)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2025-C45-004भौतिकशास्त्र (Physics)
There are two inclined surfaces of equal length (L) and same angle of inclination 45° with the horizontal. One of them is rough and the other is perfectly smooth. A given body takes 2 times as much time to slide down on rough surface than on the smooth surface. The coefficient of kinetic friction (μk) between the object and the rough surface is close to

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2025-C45-005भौतिकशास्त्र (Physics)
The kinetic energies of two similar cars A and B are 100 J and 225 J respectively. On applying breaks, car A stops after 1000 m and car B stops after 1500 m. If FA and FB are the forces applied by the breaks on cars A and B, respectively, then the ratio FA/FB is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2025-C45-009भौतिकशास्त्र (Physics)
The electric field in a plane electromagnetic wave is given by Ez = 60 cos(5x + 1.5×10⁹ t) V/m. Then expression for the corresponding magnetic field is (here subscripts denote the direction of the field)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2025-C45-010भौतिकशास्त्र (Physics)
A ball of mass 0.5 kg is dropped from a height of 40 m. The ball hits the ground and rises to a height of 10 m. The impulse imparted to the ball during its collision with the ground is (Take g = 9.8 m/s²)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2025-C45-012भौतिकशास्त्र (Physics)
A 2 amp current is flowing through two different small circular copper coils having radii ratio 1:2. The ratio of their respective magnetic moments will be

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2025-C45-013भौतिकशास्त्र (Physics)
In a certain camera, a combination of four similar thin convex lenses are arranged axially in contact. Then the power of the combination and the total magnification in comparison to the power (p) and magnification (m) for each lens will be, respectively

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2025-C45-014भौतिकशास्त्र (Physics)
An oxygen cylinder of volume 30 litre has 18.20 moles of oxygen. After some oxygen is withdrawn from the cylinder, its gauge pressure drops to 11 atmospheric pressure at temperature 27°C. The mass of the oxygen withdrawn from the cylinder is nearly equal to: [Given, R = 100/12 J mol⁻¹K⁻¹, and molecular mass of O₂ = 32, 1 atm pressure = 1.01×10⁵ N/m²]

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2025-C45-015भौतिकशास्त्र (Physics)
In some appropriate units, time (t) and position (x) relation of a moving particle is given by t = x² + x. The acceleration of the particle is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2025-C45-016भौतिकशास्त्र (Physics)
To an ac power supply of 220 V at 50 Hz, a resistor of 20 Ω, a capacitor of reactance 25 Ω and an inductor of reactance 45 Ω are connected in series. The corresponding current in the circuit and the phase angle between the current and the voltage is, respectively

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2025-C45-017भौतिकशास्त्र (Physics)
The Sun rotates around its centre once in 27 days. What will be the period of revolution if the Sun were to expand to twice its present radius without any external influence? Assume the Sun to be a sphere of uniform density.

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2025-C45-018भौतिकशास्त्र (Physics)
A model for quantized motion of an electron in a uniform magnetic field B states that the flux passing through the orbit of the electron is n(h/e) where n is an integer, h is Planck's constant and e is the magnitude of electron's charge. According to the model, the magnetic moment of an electron in its lowest energy state will be (m is the mass of the electron)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2025-C45-019भौतिकशास्त्र (Physics)
Three identical heat conducting rods are connected in series as shown in the figure. The rods on the sides have thermal conductivity 2K while that in the middle has thermal conductivity K. The left end of the combination is maintained at temperature 3T and the right end at T. The rods are thermally insulated from outside. In steady state, temperature at the left junction is T1 and that at the right junction is T2. The ratio T1/T2 is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2025-C45-020भौतिकशास्त्र (Physics)
The plates of a parallel plate capacitor are separated by d. Two slabs of different dielectric constant K1 and K2 with thickness (3/8)d and d/2, respectively are inserted in the capacitor. Due to this, the capacitance becomes two times larger than when there is nothing between the plates. If K1 = 1.25 K2, the value of K1 is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2025-C45-021भौतिकशास्त्र (Physics)
Two cities X and Y are connected by a regular bus service with a bus leaving in either direction every T min. A girl is driving scooty with a speed of 60 km/h in the direction X to Y notices that a bus goes past her every 30 minutes in the direction of her motion, and every 10 minutes in the opposite direction. Choose the correct option for the period T of the bus service and the speed (assumed constant) of the buses.

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2025-C45-022भौतिकशास्त्र (Physics)
A uniform rod of mass 20 kg and length 5 m leans against a smooth vertical wall making an angle of 60° with it. The other end rests on a rough horizontal floor. The friction force that the floor exerts on the rod is: (take g = 10 m/s²)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2025-C45-024भौतिकशास्त्र (Physics)
A balloon is made of a material of surface tension S and its inflation outlet (from where gas is filled in it) has small area A. It is filled with a gas of density ρ and takes a spherical shape of radius R. When the gas is allowed to flow freely out of it, its radius r changes from R to 0 (zero) in time T. If the speed v(r) of gas coming out of the balloon depends on r as rᵃ and T ∝ SᵅAᵝργRᵟ

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2025-C45-025भौतिकशास्त्र (Physics)
Consider the diameter of a spherical object being measured with the help of a Vernier callipers. Suppose its 10 Vernier Scale Divisions (V.S.D.) are equal to its 9 Main Scale Divisions (M.S.D.). The least division in the M.S. is 0.1 cm and the zero of V.S. is at x = 0.1 cm when the jaws of Vernier callipers are closed. If the main scale reading for the diameter is M = 5 cm and the number of coinciding vernier division is 8, the measured diameter after zero error correction, is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2025-C45-026भौतिकशास्त्र (Physics)
A parallel plate capacitor made of circular plates is being charged such that the surface charge density on its plates is increasing at a constant rate with time. The magnetic field arising due to displacement current is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2025-C45-027भौतिकशास्त्र (Physics)
An unpolarized light beam travelling in air is incident on a medium of refractive index 1.73 at Brewster's angle. Then-

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2025-C45-028भौतिकशास्त्र (Physics)
Two identical charged conducting spheres A and B have their centres separated by a certain distance. Charge on each sphere is q and the force of repulsion between them is F. A third identical uncharged conducting sphere is brought in contact with sphere A first and then with B and finally removed from both. New force of repulsion between spheres A and B (Radii of A and B are negligible compared to the distance of separation so that for calculating force between them they can be considered as point charges) is best given as

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2025-C45-029भौतिकशास्त्र (Physics)
A container has two chambers of volumes V1 = 2 litres and V2 = 3 litres separated by a partition made of a thermal insulator. The chambers contains n1 = 5 and n2 = 4 moles of ideal gas at pressures p1 = 1 atm and p2 = 2 atm, respectively. When the partition is removed, the mixture attains an equilibrium pressure of

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2025-C45-030भौतिकशास्त्र (Physics)
A particle of mass m is moving around the origin with a constant force F pulling it towards the origin. If Bohr model is used to describe its motion, the radius r of the nth orbit and the particle's speed v in the orbit depend on n as

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2025-C45-031भौतिकशास्त्र (Physics)
The radius of Martian orbit around the Sun is about 4 times the radius of the orbit of Mercury. The Martian year is 687 Earth days. Then which of the following is the length of 1 year on Mercury?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2025-C45-032भौतिकशास्त्र (Physics)
A body weight 48 N on the surface of the earth. The gravitational force experienced by the body due to the earth at a height equal to one-third the radius of the earth from its surface is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2025-C45-033भौतिकशास्त्र (Physics)
A wire of resistance R is cut into 8 equal pieces. From these pieces two equivalent resistances are made by adding four of these together in parallel. Then these two sets are added in series. The net effective resistance of the combination is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2025-C45-034भौतिकशास्त्र (Physics)
De-Broglie wavelength of an electron orbiting in the n = 2 state of hydrogen atom is close to (Given Bohr radius = 0.052 nm)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2025-C45-035भौतिकशास्त्र (Physics)
An electric dipole with dipole moment 5 × 10⁻⁶ Cm is aligned with the direction of a uniform electric field of magnitude 4 × 10⁵ N/C. The dipole is then rotated through an angle of 60° with respect to the electric field. The change in the potential energy of the dipole is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2025-C45-037भौतिकशास्त्र (Physics)
A photon and an electron (mass m) have the same energy E. The ratio (λphoton/λelectron) of their de Broglie wavelengths is (c is the speed of light)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2025-C45-041भौतिकशास्त्र (Physics)
Two gases A and B are filled at the same pressure in separate cylinders with movable pistons of radius rA and rB, respectively. On supplying an equal amount of heat to both the systems reversibly under constant pressure, the pistons of gas A and B are displaced by 16 cm and 9 cm, respectively. If the change in their internal energy is the same, then the ratio rA/rB is equal to

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2025-C45-042भौतिकशास्त्र (Physics)
A physical quantity P is related to four observations a, b, c and d as follows: P = a³b²/(c√d). The percentage errors of measurement in a, b, c and d are 1%, 3%, 2%, and 4% respectively. The percentage error in the quantity P is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2025-C45-043भौतिकशास्त्र (Physics)
The intensity of transmitted light when a polaroid sheet, placed between two crossed polarization at 22.5° from the polarization axis of one of the polaroid, is (I0 is the intensity or polarised light after passing through the first polaroid)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2025-C45-044भौतिकशास्त्र (Physics)
Two identical point masses P and Q, suspended from two separate massless springs of spring constants k1 and k2 respectively, oscillate vertically. If their maximum speeds are the same, the ratio (AQ/AP) of the amplitude AQ of mass Q to the amplitude AP of mass P is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2025-C45-045भौतिकशास्त्र (Physics)
A pipe open at both ends has a fundamental frequency f in air. The pipe is now dipped vertically in a water drum to half of its length. The fundamental frequency of the air column is now equal to

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2026-C11-001भौतिकशास्त्र (Physics)
The speed of light in vacuum is taken as unity. If light takes 6 min 40 s to reach the Earth from the Sun, the distance between the Sun and the Earth in new unit is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2026-C11-002भौतिकशास्त्र (Physics)
Match List I with List II
List IList II
AYoung's ModulusIΔd/ΔL·(L/d)
BCompressibilityIIFL/[A(ΔL)]
CBulk ModulusIII−(1/ΔP)(ΔV/V)
DPoisson's RatioIV−P(V/ΔV)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2026-C11-004भौतिकशास्त्र (Physics)
The angular speed of a flywheel is increased from 600 rpm to 1200 rpm in 10 s. The number of revolutions completed by the flywheel during this time is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2026-C11-006भौतिकशास्त्र (Physics)
A resistor is connected to a battery of 12 V emf and internal resistance 2 Ω. If the current in the circuit is 0.6 A, the terminal voltage of the battery is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2026-C11-007भौतिकशास्त्र (Physics)
A flask contains argon and chlorine in the ratio 2 : 1 by mass. The temperature of the mixture is 27°C. The ratio of root mean square speed of the molecules of the two gases is: (Atomic mass of argon = 40.0 u and molecular mass of chlorine = 70.0 u)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2026-C11-009भौतिकशास्त्र (Physics)
Match List I with List II
List IList II
AE=hνIde Broglie wavelength
BDiffraction and InterferenceIIParticle nature of light
Cλ=h/pIIIWave nature of light
DCompton effectIVEnergy of photon

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2026-C11-010भौतिकशास्त्र (Physics)
In the first excited state of hydrogen atom, the energy of its electron is –3.4 eV. The radial distance of the electron from the hydrogen nucleus in this case is approximately: (Take 1 eV = 1.6 × 10⁻¹⁹ J, e = 1.6 × 10⁻¹⁹ C and 1/4πε₀ = 9 × 10⁹ N m²/C²)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2026-C11-011भौतिकशास्त्र (Physics)
A box of mass 15 kg is kept on the floor of a stationary trolley. The coefficient of static friction between the box and the trolley is 0.12. Keeping the box in stationary state over the trolley, the maximum acceleration with which the trolley can be moved horizontally in m s⁻² is: (g = 10 m/s²)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2026-C11-013भौतिकशास्त्र (Physics)
The amount of work done to raise a mass 'm' from the surface of the Earth to a height equal to the radius of the Earth 'R' will be

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2026-C11-014भौतिकशास्त्र (Physics)
Each side of a metallic cube of mass 5.580 kg is measured to the 9.0 cm. Keeping the significant figures in view, the density of the material of the cube can be best expressed as X × 10³ kg m⁻³ where the value of X is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2026-C11-015भौतिकशास्त्र (Physics)
The following plots show variation of velocity (v) with time (t) of a ball thrown vertically upward, and falling back. Which of the following plots is/are correct?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2026-C11-016भौतिकशास्त्र (Physics)
The sum of kinetic energy and potential energy of a simple pendulum bob is 0.02 joule. The speed of the simple pendulum bob at equilibrium position is approximately: (Consider mass of the bob = 20 g)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2026-C11-017भौतिकशास्त्र (Physics)
In Young's double slit experiment, using monochromatic light of wavelength λ, the intensity of light at a point on the screen where the path difference is λ, is K units. The intensity of light at a point where the path difference is λ/3 will be

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2026-C11-019भौतिकशास्त्र (Physics)
An ac circuit contains a resistance of 1 kΩ, a capacitor of 0.1 μF and an inductor of 1 mH connected in series. The resonance frequency of the circuit is approximately

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2026-C11-020भौतिकशास्त्र (Physics)
In interference and diffraction, the light energy is redistributed. If it reduces in one region, producing a dark fringe, it increases in another region, producing a bright fringe. Statement A: As there is no gain or loss of energy, these phenomena are consistent with the principle of conservation of energy. Statement B: Diffraction and interference are characteristics exhibited only by light waves. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2026-C11-021भौतिकशास्त्र (Physics)
For a travelling harmonic wave y(x,t) = 2.0 cos 2π(10t − 0.0080x + 0.35), where x and y are in cm and t in s. The phase difference between oscillatory motion of two points separated by a distance of 0.5 m is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2026-C11-022भौतिकशास्त्र (Physics)
The magnitude and direction of the acceleration produced in a body of mass 5 kg when two mutually perpendicular forces 8 N and 6 N act on it, are respectively

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2026-C11-023भौतिकशास्त्र (Physics)
Consider two uncharged capacitors of equal capacitance 200 pF. One of them is charged by a 100 V supply and disconnected. Now this capacitor is connected to the uncharged capacitor. The amount of electrostatic energy lost in the process is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2026-C11-024भौतिकशास्त्र (Physics)
The power of a crane, which lifts a mass of 1000 kg to a height of 20 m in 10 s is: (g = 9.8 m/s²)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2026-C11-025भौतिकशास्त्र (Physics)
In a vernier calliper, 20 VSD coincide with 16 MSD (each division of length 1 mm). The least count of the vernier callipers is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2026-C11-026भौतिकशास्त्र (Physics)
When a ruler falls vertically, 5 different persons catch it with different reaction times. (g = 9.8 m s⁻²) A. Person A has reaction time of 0.20 s. B. Person B has reaction time of 0.22 s. C. Person C has reaction time of 0.18 s. D. Person D has reaction time of 0.19 s. E. Person E has reaction time of 0.21 s. What is the correct order of the distance travelled by the ruler for each person?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2026-C11-027भौतिकशास्त्र (Physics)
A uniform metallic wire having resistance 4 Ω is bent to form a square loop (ABCD) (see figure). A resistance of 2 Ω is connected between points B and D and a battery of 2 V is connected across points A and C as shown in the figure. Now the value of current (I) is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2026-C11-028भौतिकशास्त्र (Physics)
A room heater is rated 400 W, 220 V. If the supply voltage drops to 200 V, what will be the power consumed (approximately)?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2026-C11-029भौतिकशास्त्र (Physics)
A 100-turn closely wound circular coil of radius 5 cm has a magnetic field of 3.14 × 10⁻³ T at its centre. The current flowing through the coil, and the magnitude of the magnetic moment of this coil are, respectively : (Take μ0 = 4π × 10⁻⁷ T m/A)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2026-C11-030भौतिकशास्त्र (Physics)
A rectangular loop of sides 8 cm and 3 cm with a small cut, is moving out of a region of uniform magnetic field of magnitude 0.3 T directed normal to the plane of the loop. The emf developed across the cut, if the velocity of the loop is 2 cm s⁻¹, in a direction normal to the shorter side of the loop, will be

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2026-C11-031भौतिकशास्त्र (Physics)
Four statements are given (A is mass number): A. The volume of a nucleus is proportional to A^1/3. B. The volume of a nucleus is proportional to A. C. The difference in mass of an atom and its nucleus is called the mass defect. D. The difference in mass of a nucleus and its constituents is called the mass defect. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2026-C11-032भौतिकशास्त्र (Physics)
An unknown nucleus has a nuclear density of 2.29 × 10¹⁷ kg/m³ and mass of 19.926 × 10⁻²⁷ kg. Its mass number A is approximately: (Take R₀ = 1.2 × 10⁻¹⁵ m, 4π = 12.56)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2026-C11-033भौतिकशास्त्र (Physics)
Savitha, a XI standard student, while conducting an experiment to determine the effective length of a simple pendulum L, notes down the data of time taken to complete 30 oscillations as 60 s and hence calculates the length of the simple pendulum as: (Take π² = 9.8, and g = 9.8 m/s²)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2026-C11-034भौतिकशास्त्र (Physics)
An electric heater supplies heat to a system at a rate of 100 W. If the system performs work at a rate of 75 J/s, then the rate at which internal energy increases will be

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2026-C11-035भौतिकशास्त्र (Physics)
A thin wire of length 'L' and linear mass density 'm' is bent into a circular ring (in x-y plane) with centre 'C' as shown in figure. The moment of inertia of the ring about an axis yy′ will be

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2026-C11-036भौतिकशास्त्र (Physics)
A galvanometer of resistance 100 Ω gives full scale deflection for a current of 1 mA. It is converted into an ammeter of range 0–10 A. The shunt required is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2026-C11-038भौतिकशास्त्र (Physics)
The peak value of an alternating current is 5 A and frequency is 60 Hz. How long will the current, starting from zero, take to reach the peak value?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2026-C11-040भौतिकशास्त्र (Physics)
Two statements are given below: A. When the forward bias voltage across a p-n junction diode increases above a certain threshold voltage, the diode current increases significantly. B. This current is called reverse saturation current. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2026-C11-041भौतिकशास्त्र (Physics)
Which of the following statements are correct? A. Inside a conductor, the electrostatic field is zero. B. Electric field at the surface of a charged conductor does not depend on its surface charge density. C. The interior of a charged conductor can have no excess charge in the static situation. D. At the surface of a charged conductor, the electrostatic field must be normal to the surface at every point. E. The electrostatic potential is zero everywhere inside a charged conductor. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2026-C11-042भौतिकशास्त्र (Physics)
For a metal of work function 6.6 eV, which of the following incident wavelengths does not give rise to the photoelectric effect? (Take Planck's constant as 6.6 × 10⁻³⁴ J s)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2026-C11-043भौतिकशास्त्र (Physics)
In a concave lens, a ray of light emanating from the object parallel to the principal axis of the lens after refraction

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2026-C11-044भौतिकशास्त्र (Physics)
A submarine is designed to withstand an absolute pressure of 100 atm. How deep can it go below the water surface? (Consider the density of water = 1000 kg m⁻³, 1 atm = 1 × 10⁵ Pa and gravitational acceleration g = 10 m/s²)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2026-C11-045भौतिकशास्त्र (Physics)
Match List I with List II
List I (Electromagnetic wave)List II (Production)
AMicrowaveIElectrons in atoms emit light when they move higher energy level to a lower energy level
BVisible lightIIRadioactive decay of nucleus
CGamma raysIIIVibration of atoms and molecules
DInfra-red raysIVKlystron valve or magnetron valve

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
PHY · PHY-2026-C11-047भौतिकशास्त्र (Physics)
Match List I with List II
List I (Transition metal/compound/complex)List II (Catalytic Role)
AV2O5IPreparation of ammonia from N2/H2 mixture
BFeIIPolymerisation of alkynes
CPdCl2IIIPreparation of H2SO4 and SO2
DNi complexIVOxidation of ethyne to ethanal

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-001रसायनशास्त्र (Chemistry)
Which of the following will undergo an SN1 reaction most readily?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-002रसायनशास्त्र (Chemistry)
What is the pH of a 0.001 M HCl solution?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-003रसायनशास्त्र (Chemistry)
Which element has the highest electronegativity?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-004रसायनशास्त्र (Chemistry)
How many moles are present in 22 g of CO₂? (molar mass = 44 g/mol)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-005रसायनशास्त्र (Chemistry)
Which of the following acts as a Lewis acid?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2022-CR6-051रसायनशास्त्र (Chemistry)
Which statement regarding polymers is not correct?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2022-CR6-052रसायनशास्त्र (Chemistry)
At 298 K, the standard electrode potentials of Cu2+ / Cu, Zn2+ / Zn, Fe2+ / Fe and Ag+ / Ag are 0.34 V, –0.76 V, –0.44 V and 0.80 V, respectively. On the basis of standard electrode potential, predict which of the following reaction cannot occur?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2022-CR6-053रसायनशास्त्र (Chemistry)
The IUPAC name of an element with atomic number 119 is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2022-CR6-054रसायनशास्त्र (Chemistry)
Given below are two statements: Statement I: In the coagulation of a negative sol, the flocculating power of the three given ions is in the order Al3+ > Ba2+ > Na+. Statement II: In the coagulation of a positive sol, the flocculating power of the three given salts is in the order NaCl > Na2SO4 > Na3PO4. In the light of the above statements, choose the most appropriate answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2022-CR6-055रसायनशास्त्र (Chemistry)
Which of the following statement is not correct about diborane?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2022-CR6-056रसायनशास्त्र (Chemistry)
RMgX + CO₂ ───(dry ether)→ Y ───(H₃O⁺)→ RCOOH: What is Y in the above reaction?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2022-CR6-057रसायनशास्त्र (Chemistry)
What mass of 95% pure CaCO₃ will be required to neutralise 50 mL of 0.5 M HCl solution according to the following reaction? CaCO₃(s) + 2HCl(aq) → CaCl₂(aq) + CO₂(g) + 2H₂O(l) [Calculate upto second place of decimal point]

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2022-CR6-058रसायनशास्त्र (Chemistry)
Which amongst the following is incorrect statement?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2022-CR6-059रसायनशास्त्र (Chemistry)
Amongst the following which one will have maximum ‘lone pair - lone pair’ electron repulsions?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2022-CR6-060रसायनशास्त्र (Chemistry)
Choose the correct statement

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2022-CR6-061रसायनशास्त्र (Chemistry)
Given below are two statements: one is labelled as Assertion (A) and the other is labelled as Reason (R). Assertion (A): In a particular point defect, an ionic solid is electrically neutral, even if few of its cations are missing from its unit cells. Reason (R): In an ionic solid, Frenkel defect arises due to dislocation of cation from its lattice site to interstitial site, maintaining overall electrical neutrality. In the light of the above statements, choose the most appropriate answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2022-CR6-062रसायनशास्त्र (Chemistry)
Match List-I with List-II
List IList II
ALiIabsorbent for carbon dioxide
BNaIIelectrochemical cells
CKOHIIIcoolant in fast breeder reactors
DCsIVphotoelectric cell

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2022-CR6-063रसायनशास्त्र (Chemistry)
Given below are half cell reactions: MnO₄⁻ + 8H⁺ + 5e⁻ → Mn²⁺ + 4H₂O; Eº = −1.510 V ½ O₂ + 2H⁺ + 2e⁻ → H₂O; Eº = +1.223 V Will the permanganate ion, MnO₄⁻ liberate O₂ from water in the presence of an acid?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2022-CR6-064रसायनशास्त्र (Chemistry)
Match List-I with List-II
List IList II
AMgH₂IElectron precise
BGeH₄IIElectron deficient
CB₂H₆IIIElectron rich
DHFIVIonic

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2022-CR6-065रसायनशास्त्र (Chemistry)
Given below are two statements: Statement I: The acidic strength of monosubstituted nitrophenol is higher than phenol because of electron withdrawing nitro group. Statement II: o-nitrophenol, m-nitrophenol and p-nitrophenol will have same acidic strength as they have one nitro group attached to the phenolic ring. In the light of the above statements, choose the most appropriate answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2022-CR6-066रसायनशास्त्र (Chemistry)
Match List-I with List-II: List I — (a) Antacids, (b) Antihistamines, (c) Analgesics, (d) Antimicrobials. List II — I. Salvarsan, II. Morphine, III. Cimetidine, IV. Seldane. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2022-CR6-067रसायनशास्त्र (Chemistry)
The incorrect statement regarding enzymes is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2022-CR6-068रसायनशास्त्र (Chemistry)
Identify the incorrect statement from the following

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2022-CR6-069रसायनशास्त्र (Chemistry)
The incorrect statement regarding chirality is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2022-CR6-071रसायनशास्त्र (Chemistry)
The given graph is a representation of kinetics of a reaction.: (figure-dependent: plot showing straight line for rate vs concentration and another curve or line for t½ vs concentration — not transcribable as text)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2022-CR6-072रसायनशास्त्र (Chemistry)
Which one is not correct mathematical equation for Dalton’s Law of partial pressure? Here p = total pressure of gaseous mixture

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2022-CR6-073रसायनशास्त्र (Chemistry)
Given below are two statements: Statement I: Primary aliphatic amines react with HNO2 to give unstable diazonium salts. Statement II: Primary aromatic amines react with HNO2 to form diazonium salts which are stable even above 300 K. In the light of the above statements, choose the most appropriate answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2022-CR6-074रसायनशास्त्र (Chemistry)
Identify the incorrect statement from the following

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2022-CR6-075रसायनशास्त्र (Chemistry)
The IUPAC name of the complex- [Ag(H2O)2][Ag(CN)2] is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2022-CR6-076रसायनशास्त्र (Chemistry)
The pH of the solution containing 50 mL each of 0.10 M sodium acetate and 0.01 M acetic acid is [Given pKa of CH3COOH = 4.57]

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2022-CR6-078रसायनशास्त्र (Chemistry)
Match List-I with List-II
List IList II
ACyanohydrinINH2OH
BAcetalIIRNH2
CSchiff's baseIIIalcohol
DOximeIVHCN

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2022-CR6-079रसायनशास्त्र (Chemistry)
Which of the following sequence of reactions is suitable to synthesize chlorobenzene?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2022-CR6-081रसायनशास्त्र (Chemistry)
Given below are two statements : Statement I : The boiling points of aldehydes and ketones are higher than hydrocarbons of comparable molecular masses because of weak molecular association in aldehydes and ketones due to dipole - dipole interactions. Statement II : The boiling points of aldehydes and ketones are lower than the alcohols of similar molecular masses due to the absence of H-bonding. In the light of the above statements, choose the most appropriate answer from the given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2022-CR6-082रसायनशास्त्र (Chemistry)
Given below are two statements Statement I The boiling points of the following hydrides of group 16 elements increases in the order – H2O < H2S < H2Se < H2Te Statement II The boiling points of these hydrides increase with increase in molar mass. In the light of the above statements, choose the most appropriate answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2022-CR6-083रसायनशास्त्र (Chemistry)
In one molal solution that contains 0.5 mole of a solute, there is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2022-CR6-084रसायनशास्त्र (Chemistry)
Given below are two statements: one is labelled as Assertion (A) and the other is labelled as Reason (R). Assertion (A): ICI is more reactive than I2. Reason (R): I-CI bond is weaker than I-I bond. In the light of the above statements, choose the most appropriate answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2022-CR6-085रसायनशास्त्र (Chemistry)
Gadolinium has a low value of third ionisation enthalpy because of

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2022-CR6-086रसायनशास्त्र (Chemistry)विभाग B
Compound X on reaction with O3 followed by Zn/H2O gives formaldehyde and 2-methyl propanal as products. The compound X is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2022-CR6-087रसायनशास्त्र (Chemistry)विभाग B
For a first order reaction A → Products, initial concentration of A is 0.1 M, which becomes 0.001 M after 5 minutes. Rate constant for the reaction in min–1 is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2022-CR6-088रसायनशास्त्र (Chemistry)विभाग B
In the neutral or faintly alkaline medium, KMnO4 oxidises iodide into iodate. The change in oxidation state of manganese in this reaction is from

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2022-CR6-089रसायनशास्त्र (Chemistry)विभाग B
A 10.0 L flask contains 64 g of oxygen at 27ºC. (Assume O₂ gas is behaving ideally). The pressure inside the flask in bar is (Given R = 0.0831 L bar K⁻¹ mol⁻¹)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2022-CR6-090रसायनशास्त्र (Chemistry)विभाग B
Given below are two statements: Statement I: In Lucas test, primary, secondary and tertiary alcohols are distinguished on the basis of their reactivity with conc. HCl + ZnCl₂, known as Lucas Reagent. Statement II: Primary alcohols are most reactive and immediately produce turbidity at room temperature on reaction with Lucas Reagent. In the light of the above statements, choose the most appropriate answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2022-CR6-091रसायनशास्त्र (Chemistry)विभाग B
3O₂ (g) ⇌ 2O₃ (g) for the above reaction at 298 K, K_C is found to be 3.0 × 10⁻⁵⁹. If the concentration of O₂ at equilibrium is 0.040 M then concentration of O₃ in M is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2022-CR6-092रसायनशास्त्र (Chemistry)विभाग B
Match List-I with List-II
List IList II
AHaematiteIFe₃O₄
BMagnetiteIIZnCO₃
CCalamineIIIFe₂O₃
DKaoliniteIV[Al₂(OH)₄Si₂O₅]

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2022-CR6-093रसायनशास्त्र (Chemistry)विभाग B
Copper crystallises in fcc unit cell with cell edge length of 3.608 × 10⁻⁸ cm. The density of copper is 8.92 g cm⁻³. Calculate the atomic mass of copper.

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2022-CR6-094रसायनशास्त्र (Chemistry)विभाग B
The correct IUPAC name of the following compound is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2022-CR6-095रसायनशास्त्र (Chemistry)विभाग B
Find the emf of the cell in which the following reaction takes place at 298 K: Ni (s) + 2Ag⁺ (0.001M) → Ni²⁺ (0.001M) + 2Ag (s). Given that E°cell = 1.05 V, 2.303 RT/F = 0.059 at 298 K
  • A1.05 V
  • B1.0385 V
  • C1.385 V
  • D0.9615 V
उत्तर की प्रलंबित — केवळ संदर्भासाठी, गुण दिले जाणार नाहीत

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2022-CR6-096रसायनशास्त्र (Chemistry)विभाग B
The order of energy absorbed which is responsible for the color of complexes (A) [Ni(H₂O)₂(en)₂]²⁺, (B) [Ni(H₂O)₄(en)]²⁺ and (C) [Ni(en)₃]²⁺ is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2022-CR6-098रसायनशास्त्र (Chemistry)विभाग B
If radius of second Bohr orbit of the He+ ion is 105.8 pm, what is the radius of third Bohr orbit of Li 2+ ion?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2022-CR6-099रसायनशास्त्र (Chemistry)विभाग B
The pollution due to oxides of sulphur gets enhanced due to the presence of: (a) particulate matter (b) ozone (c) hydrocarbons (d) hydrogen peroxide. Choose the most appropriate answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2023-CG3-051रसायनशास्त्र (Chemistry)
In Lassaigne's extract of an organic compound, both nitrogen and sulphur are present, which gives blood red colour with Fe³⁺ due to the formation of

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2023-CG3-052रसायनशास्त्र (Chemistry)
The conductivity of centimolar solution of KCl at 25°C is 0.0210 ohm⁻¹ cm⁻¹ and the resistance of the cell containing the solution at 25°C is 60 ohm. The value of cell constant is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2023-CG3-053रसायनशास्त्र (Chemistry)
Amongst the following the total number of species NOT having eight electrons around central atom in its outermost shell, is NH₃, AlCl₃, BeCl₂, CCl₄, PCl₅

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2023-CG3-054रसायनशास्त्र (Chemistry)
Amongst the given options which of the following molecules/ion acts as a Lewis acid?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2023-CG3-055रसायनशास्त्र (Chemistry)
Which of the following reactions will NOT give primary amine as the product?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2023-CG3-056रसायनशास्त्र (Chemistry)
The number of σ bonds, π bonds and lone pair of electrons in pyridine, respectively are

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2023-CG3-057रसायनशास्त्र (Chemistry)
A compound is formed by two elements A and B. The element B forms cubic close packed structure and atoms of A occupy 1/3 of tetrahedral voids. If the formula of the compound is AₓBᵧ, then the value of x + y is in option

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2023-CG3-058रसायनशास्त्र (Chemistry)
The element expected to form largest ion to achieve the nearest noble gas configuration is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2023-CG3-059रसायनशास्त्र (Chemistry)
Weight (g) of two moles of the organic compound, which is obtained by heating sodium ethanoate with sodium hydroxide in presence of calcium oxide is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2023-CG3-060रसायनशास्त्र (Chemistry)
Which amongst the following molecules on polymerization produces neoprene?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2023-CG3-061रसायनशास्त्र (Chemistry)
Homoleptic complex from the following complexes is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2023-CG3-062रसायनशास्त्र (Chemistry)
Taking stability as the factor, which one of the following represents correct relationship?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2023-CG3-063रसायनशास्त्र (Chemistry)
Identify the product in the following reaction: benzenediazonium chloride (N₂Cl attached to benzene ring) treated with (i) Cu₂Br₂/HBr (ii) Mg/dry ether (iii) H₂O → Product

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2023-CG3-064रसायनशास्त्र (Chemistry)
The right option for the mass of CO₂ produced by heating 20 g of 20% pure limestone is (Atomic mass of Ca = 40) [CaCO₃ →(1200 K) CaO + CO₂]

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2023-CG3-065रसायनशास्त्र (Chemistry)
Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R. Assertion A: Helium is used to dilute oxygen in diving apparatus. Reason R: Helium has high solubility in O₂. In the light of the above statements, choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2023-CG3-066रसायनशास्त्र (Chemistry)
For a certain reaction, the rate = k[A]²[B], when the initial concentration of A is tripled keeping concentration of B constant, the initial rate would

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2023-CG3-067रसायनशास्त्र (Chemistry)
Which one is an example of heterogenous catalysis?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2023-CG3-068रसायनशास्त्र (Chemistry)
Which amongst the following options are correct graphical representation of Boyle's law? (figure-dependent: four plots — graph A: P vs T straight lines fanning from origin labeled V1<V2<V3; graph B: P vs V hyperbolic curves labeled T3>T2>T1; graph C: P vs 1/V straight lines fanning from origin labeled T3>T2>T1; graph D: P vs 1/V hyperbolic curves labeled T3>T2>T1 — not transcribable as text)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2023-CG3-069रसायनशास्त्र (Chemistry)
Match List I with List II
List IList II
ACokeICarbon atoms are sp3 hybridised
BDiamondIIUsed as a dry lubricant
CFullereneIIIUsed as a reducing agent
DGraphiteIVCage like molecules

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2023-CG3-070रसायनशास्त्र (Chemistry)
Select the correct statements from the following: A. Atoms of all elements are composed of two fundamental particles. B. The mass of the electron is 9.10939 × 10⁻³¹ kg. C. All the isotopes of a given element show same chemical properties. D. Protons and electrons are collectively known as nucleons. E. Dalton's atomic theory, regarded the atom as an ultimate particles of matter. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2023-CG3-071रसायनशास्त्र (Chemistry)
Consider the following reaction and identify the product (P). CH₃-CH(CH₃)-CH(OH)-CH₃ (3-Methylbutan-2-ol) --HBr--> Product (P)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2023-CG3-072रसायनशास्त्र (Chemistry)
Some tranquilizers are listed below. Which one from the following belongs to barbiturates?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2023-CG3-073रसायनशास्त्र (Chemistry)
Which of the following statements are NOT correct? A. Hydrogen is used to reduce heavy metal oxides to metals. B. Heavy water is used to study reaction mechanism. C. Hydrogen is used to make saturated fats from oils. D. The H–H bond dissociation enthalpy is lowest as compared to a single bond between two atoms of any elements. E. Hydrogen reduces oxides of metals that are more active than iron. Choose the most appropriate answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2023-CG3-074रसायनशास्त्र (Chemistry)
Identify product (A) in the following reaction (figure-dependent: a diketone — 1-(3-(3-acetylcyclohexyl)phenyl)ethan-1-one, i.e. a cyclohexane ring bearing an acetyl group and a meta-diacetylphenyl group, reacted with Zn-Hg/conc. HCl (Clemmensen reduction) to give product A + 2H₂O; answer options are structural formulas — not transcribable as text)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2023-CG3-075रसायनशास्त्र (Chemistry)
The correct order of energies of molecular orbitals of N₂ molecule, is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2023-CG3-076रसायनशास्त्र (Chemistry)
Given below are two statements: Statement I: A unit formed by the attachment of a base to 1' position of sugar is known as nucleoside. Statement II: When nucleoside is linked to phosphorous acid at 5'-position of sugar moiety, we get nucleotide. In the light of the above statements, choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2023-CG3-077रसायनशास्त्र (Chemistry)
Intermolecular forces are forces of attraction and repulsion between interacting particles that will include: A. dipole - dipole forces B. dipole - induced dipole forces C. hydrogen bonding D. covalent bonding E. dispersion forces. Choose the most appropriate answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2023-CG3-078रसायनशास्त्र (Chemistry)
Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R. Assertion A: In equation ΔrG = −nFEcell, value of ΔrG depends on n. Reason R: Ecell is an intensive property and ΔrG is an extensive property. In the light of the above statements, choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2023-CG3-079रसायनशास्त्र (Chemistry)
The relation between nm, (nm = the number of permissible values of magnetic quantum number (m)) for a given value of azimuthal quantum number (l), is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2023-CG3-080रसायनशास्त्र (Chemistry)
Which one of the following statements is correct?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2023-CG3-081रसायनशास्त्र (Chemistry)
The given compound (cyclohexenyl ring)–CH=CH–CH(X)–CH₂CH₃ is an example of

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2023-CG3-082रसायनशास्त्र (Chemistry)
Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R: Assertion A: Metallic sodium dissolves in liquid ammonia giving a deep blue solution, which is paramagnetic. Reason R: The deep blue solution is due to the formation of amide. In the light of the above statements, choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2023-CG3-083रसायनशास्त्र (Chemistry)
Complete the following reaction: cyclohexanone [A] --HCN--> 1-hydroxycyclohexane-1-carbonitrile [B] --conc. H₂SO₄, Δ--> [C]. [C] is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2023-CG3-084रसायनशास्त्र (Chemistry)
The stability of Cu²⁺ is more than Cu⁺ salts in aqueous solution due to

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2023-CG3-085रसायनशास्त्र (Chemistry)
Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R: Assertion A: A reaction can have zero activation energy. Reason R: The minimum extra amount of energy absorbed by reactant molecules so that their energy becomes equal to threshold value, is called activation energy. In the light of the above statements, choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2023-CG3-086रसायनशास्त्र (Chemistry)विभाग B
Consider the following compounds/species (figure-dependent: i. naphthalene, ii. cyclopentadienyl anion (5-membered ring with lone pair, negative charge), iii. cyclobutadiene (4-membered ring), iv. cyclopropenyl anion (3-membered ring with lone pair, negative charge), v. cyclopropenyl cation (3-membered ring, positive charge), vi. cyclooctatetraene (8-membered ring), vii. anthracene — not transcribable as text). The number of compounds/species which obey Huckel's rule is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2023-CG3-087रसायनशास्त्र (Chemistry)विभाग B
Consider the following reaction: benzyl phenyl ether (PhCH₂-O-Ph) --HI, Δ--> A + B. Identify products A and B.

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2023-CG3-088रसायनशास्त्र (Chemistry)विभाग B
The reaction that does NOT take place in a blast furnace between 900 K to 1500 K temperature range during extraction of iron is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2023-CG3-089रसायनशास्त्र (Chemistry)विभाग B
Identify the major product obtained in the following reaction (figure-dependent: 2-hydroxy-1,4-naphthoquinone-type aldehyde reacting with 2 [Ag(NH3)2]+ (Tollens' reagent) then 3⁻OH/Δ, giving a substituted benzene product; answer options are substituted benzene structures with combinations of -CH(OH)-, -CH2OH, -COO⁻, and acetyl groups — not transcribable as text)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2023-CG3-090रसायनशास्त्र (Chemistry)विभाग B
Which amongst the following options is the correct relation between change in enthalpy and change in internal energy?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2023-CG3-091रसायनशास्त्र (Chemistry)विभाग B
Pumice stone is an example of

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2023-CG3-092रसायनशास्त्र (Chemistry)विभाग B
Which of the following statements are INCORRECT? A. All the transition metals except scandium form MO oxides which are ionic. B. The highest oxidation number corresponding to the group number in transition metal oxides is attained in Sc₂O₃ to Mn₂O₇. C. Basic character increases from V₂O₃ to V₂O₄ to V₂O₅. D. V₂O₄ dissolves in acids to give VO₄³⁻ salts. E. CrO is basic but Cr₂O₃ is amphoteric. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2023-CG3-093रसायनशास्त्र (Chemistry)विभाग B
On balancing the given redox reaction, aCr₂O₇²⁻ + bSO₃²⁻(aq) + cH⁺(aq) → 2aCr³⁺(aq) + bSO₄²⁻(aq) + (c/2)H₂O(l), the coefficients a, b and c are found to be, respectively

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2023-CG3-094रसायनशास्त्र (Chemistry)विभाग B
What fraction of one edge centred octahedral void lies in one unit cell of fcc?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2023-CG3-095रसायनशास्त्र (Chemistry)विभाग B
Which complex compound is most stable?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2023-CG3-096रसायनशास्त्र (Chemistry)विभाग B
Which amongst the following will be most readily dehydrated under acidic conditions? (figure-dependent: four 5-carbon chain structures with NO₂ and OH substituents at various positions, one option also showing two OH groups (a diol) — not transcribable as text)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2023-CG3-097रसायनशास्त्र (Chemistry)विभाग B
Given below are two statements: Statement I: The nutrient deficient water bodies lead to eutrophication. Statement II: Eutrophication leads to decrease in the level of oxygen in the water bodies. In the light of the above statements, choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2023-CG3-098रसायनशास्त्र (Chemistry)विभाग B
Identify the final product [D] obtained in the following sequence of reactions. CH₃CHO --(i) LiAlH₄ (ii) H₃O⁺--> [A] --H₂SO₄, Δ--> [B] --HBr--> [C], then [C] + m-bromostyrene-type aryl bromide (1-bromo-3-vinylbenzene) --Na/dry ether--> [D]

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2023-CG3-099रसायनशास्त्र (Chemistry)विभाग B
The equilibrium concentrations of the species in the reaction A + B ⇌ C + D are 2, 3, 10 and 6 mol L⁻¹, respectively at 300 K. ΔG° for the reaction is (R = 2 cal/mol K)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2023-CG3-100रसायनशास्त्र (Chemistry)विभाग B
Match List I with List II
List I (Oxoacids of Sulphur)List II (Bonds)
APeroxodisulphuric acidITwo S−OH, Four S=O, One S−O−S
BSulphuric acidIITwo S−OH, One S=O
CPyrosulphuric acidIIITwo S−OH, Four S=O, One S−O−O−S
DSulphurous acidIVTwo S−OH, Two S=O

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2024-CT3-051रसायनशास्त्र (Chemistry)
Match List-I with List-II
List IList II
A1 mol of H2O to O2I3F
B1 mol of MnO4– to Mn2+II2F
C1.5 mol of Ca from molten CaCl2III1F
D1 mol of FeO to Fe2O3IV5F

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2024-CT3-052रसायनशास्त्र (Chemistry)
Which reaction is NOT a redox reaction?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2024-CT3-053रसायनशास्त्र (Chemistry)
Intramolecular hydrogen bonding is present in
  • A(figure-dependent: structure not transcribable as text — likely catechol or o-nitrophenol)
  • BHF
  • C(figure-dependent: structure not transcribable as text — likely salicylaldehyde)
  • D(figure-dependent: structure not transcribable as text — likely acetylacetone enol form)
उत्तर की प्रलंबित — केवळ संदर्भासाठी, गुण दिले जाणार नाहीत

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2024-CT3-054रसायनशास्त्र (Chemistry)
Fehling’s solution ‘A’ is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2024-CT3-055रसायनशास्त्र (Chemistry)
1 gram of sodium hydroxide was treated with 25 mL of 0.75 M HCl solution, the mass of sodium hydroxide left unreacted is equal to

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2024-CT3-056रसायनशास्त्र (Chemistry)
Match List-I with List-II
List IList II
ANH3ITrigonal Pyramidal
BBrF5IISquare Planar
CXeF4IIIOctahedral
DSF6IVSquare Pyramidal

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2024-CT3-057रसायनशास्त्र (Chemistry)
The E° value for the Mn3+/Mn2+ couple is more positive than that of Cr3+/Cr2+ or Fe3+/Fe2+ due to change of

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2024-CT3-058रसायनशास्त्र (Chemistry)
Match List-I with List-II
List IList II
AIsothermal processINo heat exchange
BIsochoric processIICarried out at constant temperature
CIsobaric processIIICarried out at constant volume
DAdiabatic processIVCarried out at constant pressure

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2024-CT3-059रसायनशास्त्र (Chemistry)
Activation energy of any chemical reaction can be calculated if one knows the value of

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2024-CT3-060रसायनशास्त्र (Chemistry)
A compound with a molecular formula of C6H14 has two tertiary carbons. Its IUPAC name is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2024-CT3-061रसायनशास्त्र (Chemistry)
‘Spin only’ magnetic moment is same for which of the following ions? A. Ti3+ B. Cr2+ C. Mn2+ D. Fe2+ E. Sc3+ Choose the most appropriate answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2024-CT3-062रसायनशास्त्र (Chemistry)
Arrange the following elements in increasing order of electronegativity: N, O, F, C, Si Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2024-CT3-063रसायनशास्त्र (Chemistry)
Which one of the following alcohols reacts instantaneously with Lucas reagent?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2024-CT3-064रसायनशास्त्र (Chemistry)
Given below are two statements:<br>Statement I: Both [Co(NH3)6]3+ and [CoF6]3− complexes are octahedral but differ in their magnetic behaviour.<br>Statement II: [Co(NH3)6]3+ is diamagnetic whereas [CoF6]3− is paramagnetic.<br>In the light of the above statements, choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2024-CT3-065रसायनशास्त्र (Chemistry)
Given below are two statements:<br>Statement I : The boiling point of hydrides of Group 16 elements follow the order H2O > H2Te > H2Se > H2S.<br>Statement II : On the basis of molecular mass, H2O is expected to have lower boiling point than the other members of the group but due to the presence of extensive H-bonding in H2O, it has higher boiling point.<br>In the light of the above statements, choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2024-CT3-066रसायनशास्त्र (Chemistry)
Match List I with List II
List IList II
AmlIshape of orbital
BmsIIsize of orbital
ClIIIorientation of orbital
DnIVorientation of spin of electron

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2024-CT3-067रसायनशास्त्र (Chemistry)
Match List I with List II: List I (Reaction) — A., B., C., D. List II (Reagents/Condition) — I. Anhyd.AlCl3, II. CrO3, III. KMnO4/KOH, Δ, IV. (i) O3 (ii) Zn-H2O. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2024-CT3-069रसायनशास्त्र (Chemistry)
The reagents with which glucose does not react to give the corresponding tests/products are A. Tollen’s reagent B. Schiff’s reagent C. HCN D. NH2OH E. NaHSO3 Choose the correct options from the given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2024-CT3-070रसायनशास्त्र (Chemistry)
Match List I with List II: List-I — A. ethane, B. ethene, C. carbon molecule, C2, D. ethyne. List-II — I. one σ-bonds and two π-bonds, II. two π-bonds, III. one σ-bond, IV. one σ-bond and one π-bond. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2024-CT3-071रसायनशास्त्र (Chemistry)
Among Group 16 elements, which one does NOT show –2 oxidation state?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2024-CT3-072रसायनशास्त्र (Chemistry)
For the reaction 2A ⇌ B + C, Kc = 4 × 10–3. At a given time, the composition of reaction mixture is: [A] = [B] = [C] = 2 × 10–3 M. Then, which of the following is correct?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2024-CT3-074रसायनशास्त्र (Chemistry)
In which of the following equilibria, Kp and Kc are NOT equal?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2024-CT3-075रसायनशास्त्र (Chemistry)
Given below are two statements: Statement I : The boiling point of three isomeric pentanes follows the order. n-pentane > isopentane > neopentane Statement II : When branching increases, the molecule attains a shape of sphere. This results in smaller surface area for contact, due to which the intermolecular forces between the spherical molecules are weak, thereby lowering the boiling point. In the light of the above statements, choose the most appropriate answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2024-CT3-077रसायनशास्त्र (Chemistry)
The energy of an electron in the ground state (n =1) for He+ ion is –x J, then that for an electron in n = 2 state for Be3+ ion in J is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2024-CT3-078रसायनशास्त्र (Chemistry)
In which of the following processes entropy increases? A. A liquid evaporates to vapour. B. Temperature of a crystalline solid lowered from 130 K to 0 K. C. 2NaHCO3(s) → Na2CO3(s) + CO2(g) + H2O(g) D. Cl2(g) → 2Cl(g) Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2024-CT3-079रसायनशास्त्र (Chemistry)
On heating some solid substance change from solid to vapour state without passing through liquid state. The technique used for the purification of such solid substances based on the above principle is known as

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2024-CT3-080रसायनशास्त्र (Chemistry)
Match List-I with List-II
List IList II
A[Co(NH3)5(NO2)]Cl2ISolvate isomerism
B[Co(NH3)5(SO4)]BrIILinkage isomerism
C[Co(NH3)6][Cr(CN)6]IIIIonization isomerism
D[Co(H2O)6]Cl3IVCoordination isomerism

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2024-CT3-081रसायनशास्त्र (Chemistry)
Given below are two statements: Statement I: Aniline does not undergo Friedel-Crafts alkylation reaction. Statement II: Aniline cannot be prepared through Gabriel synthesis. In the light of the above statements, choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2024-CT3-082रसायनशास्त्र (Chemistry)
Arrange the following elements in increasing order of first ionization enthalpy: Li, Be, B, C, N. Choose the correct answer from options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2024-CT3-083रसायनशास्त्र (Chemistry)
The highest number of helium atoms is in

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2024-CT3-084रसायनशास्त्र (Chemistry)
The most stable carbocation among the following is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2024-CT3-085रसायनशास्त्र (Chemistry)
The Henry’s law constant (KH) values of three gases (A, B, C) in water are 145, 2 × 10–5 and 35 kbar, respectively. The solubility of these gases in water follow the order

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2024-CT3-086रसायनशास्त्र (Chemistry)विभाग B
A compound X contains 32% of A, 20% of B and remaining percentage of C. Then, the empirical formula of X is: (Given atomic masses of A = 64; B = 40; C = 32u)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2024-CT3-087रसायनशास्त्र (Chemistry)विभाग B
The products A and B obtained in the following reactions, respectively, are 3ROH + PCl3 → 3RCl + A; ROH + PCl5 → RCl + HCl + B.

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2024-CT3-088रसायनशास्त्र (Chemistry)विभाग B
The plot of osmotic pressure (Π) vs concentration (mol L–1) for a solution gives a straight line with slope 25.73 L bar mol–1. The temperature at which the osmotic pressure measurement is done is: (Use R = 0.083 L bar mol–1 K–1)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2024-CT3-090रसायनशास्त्र (Chemistry)विभाग B
Given below are two statements: Statement I: [Co(NH3)6]3+ is a homoleptic complex whereas [Co(NH3)4Cl2]+ is a heteroleptic complex. Statement II: Complex [Co(NH3)6]3+ has only one kind of ligands but [Co(NH3)4Cl2]+ has more than one kind of ligands. In the light of the above statements, choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2024-CT3-091रसायनशास्त्र (Chemistry)विभाग B
During the preparation of Mohr’s salt solution (Ferrous ammonium sulphate), which of the following acid is added to prevent hydrolysis of Fe2+ ion?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2024-CT3-092रसायनशास्त्र (Chemistry)विभाग B
Identify the correct answer.

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2024-CT3-093रसायनशास्त्र (Chemistry)विभाग B
Given below are certain cations. Using inorganic qualitative analysis, arrange them in increasing group number from 0 to VI. A. Al3+ B. Cu2+ C. Ba2+ D. Co2+ E. Mg2+. Choose the correct answer from the option given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2024-CT3-094रसायनशास्त्र (Chemistry)विभाग B
Identify the major product C formed in the following reaction sequence: CH3−CH2−CH2−I ⎯⎯NaCN→ A; A ⎯⎯OH−/Partial hydrolysis→ B ⎯⎯NaBr, NaOH→ C (major).

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2024-CT3-095रसायनशास्त्र (Chemistry)विभाग B
The rate of a reaction quadruples when temperature changes from 27ºC to 57ºC. Calculate the energy of activation. Given R = 8.314 J K–1 mol–1, log 4 = 0.6021

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2024-CT3-096रसायनशास्त्र (Chemistry)विभाग B
Consider the following reaction in a sealed vessel at equilibrium with concentrations of N2 = 3.0 × 10–3 M, O2 = 4.2×10–3 M and NO = 2.8×10–3 M. 2NO(g) ⇌ N2(g) + O2(g). If 0.1 mol L–1 of NO(g) is taken in a closed vessel, what will be degree of dissociation (α) of NO(g) at equilibrium?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2024-CT3-097रसायनशास्त्र (Chemistry)विभाग B
The work done during reversible isothermal expansion of one mole of hydrogen gas at 25ºC from pressure of 20 atmosphere to 10 atmosphere is: (Given R = 2.0 cal K–1mol–1)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2024-CT3-098रसायनशास्त्र (Chemistry)विभाग B
Mass in grams of copper deposited by passing 9.6487 A current through a voltmeter containing copper sulphate solution for 100 seconds is: (Given: Molar mass of Cu : 63 g mol–1, 1F = 96487 C)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2024-CT3-100रसायनशास्त्र (Chemistry)विभाग B
The pair of lanthanoid ions which are diamagnetic is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2025-C45-046रसायनशास्त्र (Chemistry)
The ratio of the wavelengths of the light absorbed by a Hydrogen atom when it undergoes n = 2 → n = 3 and n = 4 → n = 6 transitions, respectively, is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2025-C45-047रसायनशास्त्र (Chemistry)
Which of the following statements are true? A. Unlike Ga that has a very high melting point, Cs has a very low melting point. B. On Pauling scale, the electronegativity values of N and Cl are not the same. C. Ar, K⁺, Cl⁻, Ca²⁺ and S²⁻ are all isoelectronic species. D. The correct order of the first ionization enthalpies of Na, Mg, Al, and Si is Si > Al > Mg > Na. E. The atomic radius of Cs is greater than that of Li and Rb. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2025-C45-048रसायनशास्त्र (Chemistry)
Match List-I with List-II
List I (Ion)List II (Group Number in Cation Analysis)
ACo²⁺IGroup-I
BMg²⁺IIGroup-III
CPb²⁺IIIGroup-IV
DAl³⁺IVGroup-VI

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2025-C45-050रसायनशास्त्र (Chemistry)
Energy and radius of first Bohr orbit of He⁺ and Li²⁺ are [Given RH = 2.18×10⁻¹⁸ J, a0 = 52.9 pm]

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2025-C45-051रसायनशास्त्र (Chemistry)
Which of the following are paramagnetic? A. [NiCl4]²⁻ B. Ni(CO)4 C. [Ni(CN)4]²⁻ D. [Ni(H2O)6]²⁺ E. Ni(PPh3)4. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2025-C45-052रसायनशास्त्र (Chemistry)
Given below are two statements: Statement I: Like nitrogen that can form ammonia, arsenic can form arsine. Statement II: Antimony cannot form antimony pentoxide. In the light of the above statements, choose the most appropriate answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2025-C45-053रसायनशास्त्र (Chemistry)
Which among the following electronic configurations belong to main group elements? A. [Ne]3s¹ B. [Ar]3d³4s² C. [Kr]4d¹⁰5s²5p⁵ D. [Ar]3d¹⁰4s¹ E. [Rn]5f⁰6d²7s². Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2025-C45-054रसायनशास्त्र (Chemistry)
Dalton's Atomic theory could not explain which of the following?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2025-C45-055रसायनशास्त्र (Chemistry)
Consider the following compounds: KO2, H2O2 and H2SO4. The oxidation states of the underlined elements in them are, respectively,

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2025-C45-056रसायनशास्त्र (Chemistry)
If the half-life (t1/2) for a first order reaction is 1 minute, then the time required for 99.9% completion of the reaction is closet to

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2025-C45-057रसायनशास्त्र (Chemistry)
The correct order of the wavelength of light absorbed by the following complexes is, A. [Co(NH3)6]³⁺ B. [Co(CN)6]³⁻ C. [Cu(H2O)4]²⁺ D. [Ti(H2O)6]³⁺. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2025-C45-058रसायनशास्त्र (Chemistry)
Which one of the following compounds can exist as cis-trans isomers?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2025-C45-059रसायनशास्त्र (Chemistry)
Phosphoric acid ionizes in three steps with their ionization constant values Ka1, Ka2 and Ka3, respectively, while K is the overall ionization constant. Which of the following statements are true? A. log K = log Ka1 + log Ka2 + log Ka3 B. H3PO4 is stronger acid than H2PO4⁻ and HPO4²⁻. C. Ka1 > Ka2 > Ka3 D. Ka1 = (Ka3 + Ka2)/2. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2025-C45-060रसायनशास्त्र (Chemistry)
Which one of the following reactions does NOT give benzene as the product?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2025-C45-061रसायनशास्त्र (Chemistry)
If the molar conductivity (Λm) of a 0.050 mol L⁻¹ solution of a monobasic weak acid is 90 S cm² mol⁻¹, its extent (degree) of dissociation will be [Assume Λ°+ = 349.6 S cm² mol⁻¹ and Λ°− = 50.4 S cm² mol⁻¹]

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2025-C45-062रसायनशास्त्र (Chemistry)
Given below are two statements: Statement I: A hypothetical diatomic molecule with bond order zero is quite stable. Statement II: As bond order increases, the bond length increases. In the light of the above statements, chose the most appropriate answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2025-C45-063रसायनशास्त्र (Chemistry)
Out of the following complex compounds, which of the compound will be having the minimum conductance is solution?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2025-C45-064रसायनशास्त्र (Chemistry)
Match the List-I with List-II
List IList II
AXeO3Isp³d; linear
BXeF2IIsp³; pyramidal
CXeOF4IIIsp³d³; distorted octahedral
DXeF6IVsp³d²; square pyramidal

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2025-C45-066रसायनशास्त्र (Chemistry)
Match the List-I with List-II
List I (Example)List II (Type of Solution)
AHumidityISolid in solid
BAlloysIILiquid in gas
CAmalgamsIIISolid in gas
DSmokeIVLiquid in solid

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2025-C45-067रसायनशास्त्र (Chemistry)
The correct order of decreasing basic strength of the given amines is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2025-C45-068रसायनशास्त्र (Chemistry)
Among the following, choose the ones with equal number of atoms. A. 212 g of Na2CO3 (s) [molar mass = 106 g] B. 248 g of Na2O (s) [molar mass = 62 g] C. 240 g of NaOH (s) [molar mass = 40 g] D. 12 g of H2(g) [molar mass = 2 g] E. 220 g of CO2(g) [molar mass = 44 g]. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2025-C45-069रसायनशास्त्र (Chemistry)
Match the List-I with List-II
List I (Name of Vitamin)List II (Deficiency disease)
AVitamin B12ICheilosis
BVitamin DIIConvulsions
CVitamin B2IIIRickets
DVitamin B6IVPernicious anaemia

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2025-C45-070रसायनशास्त्र (Chemistry)
The correct order of decreasing acidity of the following aliphatic acids is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2025-C45-071रसायनशास्त्र (Chemistry)
Given below are two statements; Statement I: Ferromagnetism is considered as an extreme form of paramagnetism. Statement II: The number of unpaired electrons in a Cr²⁺ ion (Z=24) is the same as that of a Nd³⁺ ion (Z=60). In the light of the above statements, choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2025-C45-072रसायनशास्त्र (Chemistry)
Match the List-I with List-II
List I (Mixture)List II (Method of Separation)
ACHCl3 + C6H5NH2IDistillation under reduced pressure
BCrude oil in petroleum industryIISteam distillation
CGlycerol from spent-lyeIIIFractional distillation
DAniline-waterIVSimple distillation

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2025-C45-073रसायनशास्त्र (Chemistry)
For the reaction A(g) ⇌ 2B(g), the backward reaction rate constant is higher than the forward reaction rate constant by a factor of 2500, at 1000 K. [Given: R= 0.0831 L atm mol⁻¹ K⁻¹] KP for the reaction at 1000 K is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2025-C45-074रसायनशास्त्र (Chemistry)
Given below are two statements: Statement I: Benzenediazonium salt is prepared by the reaction of aniline with nitrous acid at 273-278 K. It decomposes easily in the dry state. Statement II: Insertion of iodine into the benzene ring is difficult and hence iodobenzene is prepared through the reaction of benzenediazonium salt with KI. In the light of the above statements, choose the most appropriate answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2025-C45-075रसायनशास्त्र (Chemistry)
How many products (including stereoisomers) are expected from monochlorination of the following compound? H3C-CH(CH3)-CH2-CH3 (2-methylbutane)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2025-C45-077रसायनशास्त्र (Chemistry)
Which one of the following compounds does not decolourize bromine water?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2025-C45-079रसायनशास्त्र (Chemistry)
Which of the following aqueous solution will exhibit highest boiling point?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2025-C45-080रसायनशास्त्र (Chemistry)
Match List-I with List-II
List IList II
AHaber processIFe catalyst
BWacker oxidationIIPdCl2
CWilkinson catalystIII[(PPh3)3RhCl]
DZiegler catalystIVTiCl4 with Al(CH3)3

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2025-C45-081रसायनशास्त्र (Chemistry)
5 moles of liquid X and 10 moles of liquid Y make a solution having a vapour pressure of 70 torr. The vapour pressures of pure X and Y are 63 torr and 78 torr respectively. Which of the following is true regarding the described solution?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2025-C45-082रसायनशास्त्र (Chemistry)
Sugar 'X' A. is found in honey. B. is a keto sugar. C. exists in α and β − anomeric forms. D. is laevorotatory. 'X' is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2025-C45-083रसायनशास्त्र (Chemistry)
Identify the suitable reagent for the following conversion. Methyl benzoate (Ph-COOCH3) → benzaldehyde (Ph-CHO)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2025-C45-084रसायनशास्त्र (Chemistry)
Given below are two statement: one is labelled as Assertion (A) and the other is labelled as Reason (R): Assertion (A): 1-iodopropane (CH3CH2CH2I) undergoes SN2 reaction faster than 1-chloropropane (CH3CH2CH2Cl). Reason (R): Iodine is a better leaving group because of its large size. In the light of the above statements, choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2025-C45-085रसायनशास्त्र (Chemistry)
The standard heat of formation, in kcal/mol of Ba²⁺ is: [Given: standard heat of formation of SO4²⁻ ion (aq)= −216 kcal/mol, standard heat of crystallization of BaSO4(s) = −4.5 kcal/mol, standard heat of formation of BaSO4(s) = −349 kcal/mol]

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2025-C45-086रसायनशास्त्र (Chemistry)
Total number of possible isomers (both structural as well as stereoisomers) of cyclic ethers of molecular formula C4H8O is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2025-C45-087रसायनशास्त्र (Chemistry)
Identify the correct orders against the property mentioned A. H2O > NH3 > CHCl3 - dipole moment B. XeF4 > XeO3 > XeF2 − number of lone pairs on central atom C. O−H > C−H > N−O − bond length D. N2 > O2 > H2 − bond enthalpy. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2025-C45-088रसायनशास्त्र (Chemistry)
Higher yield of NO in N2(g) + O2 ⇌ 2NO(g) can be obtained at [ΔH of the reaction = + 180.7 kJ mol⁻¹] A. higher temperature B. lower temperature C. higher concentration of N2 D. higher concentration of O2. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2025-C45-089रसायनशास्त्र (Chemistry)
If the rate constant of a reaction is 0.03 s⁻¹, how much time does it take for 7.2 mol L⁻¹ concentration of the reactant to get reduced to 0.9 mol L⁻¹? (Given: log 2 = 0.301)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2025-C45-090रसायनशास्त्र (Chemistry)
Which one of the following reactions does NOT belong to "Lassaigne's test"?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2026-C11-046रसायनशास्त्र (Chemistry)
Select the reagents that reduce nitriles to primary amines. A. (i) LiAlH₄; (ii) H₂O B. Sn + HCl C. H₂/Ni D. Na(Hg)/C₂H₅OH E. Br₂/aq. NaOH Choose the correct answer from the options given below.

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2026-C11-048रसायनशास्त्र (Chemistry)
Consider the following reaction : 2A(g) + B(g) → 2D(g). ΔU⊖ = −10 kJ mol⁻¹ and ΔS⊖ = −44 JK⁻¹ at 298 K. Identify the correct option with ΔG⊖ for the reaction and spontaneity of the reaction at 298 K. (Given : R = 8.31 J mol⁻¹ K⁻¹)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2026-C11-049रसायनशास्त्र (Chemistry)
Match List I with List II
List I (Quantum Numbers, n and l)List II (Orbital)
An=2, l=1I3d
Bn=4, l=0II2p
Cn=5, l=3III4s
Dn=3, l=2IV5f

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2026-C11-050रसायनशास्त्र (Chemistry)
In a qualitative analysis, Bi³⁺ is detected by appearance of precipitate of BiO(OH)(s). Calculate pH when the following equilibrium exists at 298 K. BiO(OH)(s) ⇌ BiO⁺(aq) + OH⁻(aq), K = 4 × 10⁻¹⁰ (Given : log2 = 0.3010)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2026-C11-051रसायनशास्त्र (Chemistry)
The correct statement with regard to the secondary structure of DNA/RNA is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2026-C11-052रसायनशास्त्र (Chemistry)
The pair of molecules that are metamers among the following is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2026-C11-053रसायनशास्त्र (Chemistry)
Match List I with List II
List I (Complex)List II (Type of isomerism)
A[Pt(NH3)2Cl2]IOptical
B[Co(en)3]3+IISolvate
C[Co(NH3)5NO2]Cl2IIIGeometrical
D[Cr(H2O)6]Cl3IVLinkage

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2026-C11-054रसायनशास्त्र (Chemistry)
Match List I with List II
List I (Order of reaction)List II (Unit of rate constant)
AZero orderImol⁻¹ L s⁻¹
BFirst orderIImol⁻² L² s⁻¹
CSecond orderIIIs⁻¹
DThird orderIVmol L⁻¹ s⁻¹

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2026-C11-055रसायनशास्त्र (Chemistry)
The correct IUPAC name of the following compound is: CH₃–CH₂–CH–CH₂–CH–CH₂–CH₃, with an ethyl (CH₂CH₃) branch at C3 and a methyl (CH₃) branch at C5

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2026-C11-056रसायनशास्त्र (Chemistry)
A bulb is rated at 150 watt, converting 8% energy into light. If energy of one photon is 4.42 × 10⁻¹⁹ J, how many photons are emitted by the bulb per second?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2026-C11-057रसायनशास्त्र (Chemistry)
Methane reacts with steam at 1273 K in the presence of nickel catalyst to form

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2026-C11-059रसायनशास्त्र (Chemistry)
Match List I with List II
List IList II
AC2H4I3σ bonds and 2π bonds
BC2H2II3σ bonds and one lone pair
CCH4III4σ bonds
DNH3IV5σ bonds and 1π bond

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2026-C11-060रसायनशास्त्र (Chemistry)
The following two reactions give the same foul smelling product Z. C₂H₅Cl →(X)→ Z; C₂H₅CONH₂ →(Br₂, NaOH)→ Y →(CHCl₃/ethanolic KOH, Δ)→ Z. X and Z, respectively, are

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2026-C11-061रसायनशास्त्र (Chemistry)
The number of hydrogen atoms present in 5.4 g of urea is: (Given: Molar mass of urea : 60 g mol⁻¹, N_A : 6.022×10²³ particles mol⁻¹)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2026-C11-062रसायनशास्त्र (Chemistry)
Identify the incorrect statement from the following

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2026-C11-063रसायनशास्त्र (Chemistry)
Which one of the following is an ambidentate ligand?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2026-C11-064रसायनशास्त्र (Chemistry)
The correct order of increasing metallic character of Na, Be, P, Mg and Si is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2026-C11-065रसायनशास्त्र (Chemistry)
Match List I with List II
List IList II (reagents/conditions)
ACumene → PhenolI(i) Oleum; (ii) NaOH, Δ; (iii) H⁺
BCH₃COOH → CH₃CH₂OHII(i) O₂; (ii) H₂O/H⁺
CCH₃CH₂CH₂OH → CH₃-CH(OH)-CH₃III(i) CH₃OH, H⁺; (ii) H₂, catalyst
DBenzene → PhenolIV(i) conc. H₂SO₄, Δ; (ii) H⁺/H₂O

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2026-C11-066रसायनशास्त्र (Chemistry)
Although +3 oxidation state is most common in lanthanoids, cerium still shows +4 oxidation state

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2026-C11-067रसायनशास्त्र (Chemistry)
In the following reaction sequence, X and Z respectively are : CH₃CH₂CH₂–OH + PCl₅ → CH₃CH₂CH₂Cl + X + HCl; then alc. KOH, Δ; then Z ←(HBr, (C₆H₅CO)₂O₂)— Y

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2026-C11-068रसायनशास्त्र (Chemistry)
Match List I with List II
List I (Complex/ion)List II (Shape/geometry)
A[PtCl2(NH3)2]IOctahedral
B[Co(NH3)6]Cl3IITrigonal bipyramidal
C[NiCl4]2-IIISquare planar
D[Fe(CO)5]IVTetrahedral

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2026-C11-069रसायनशास्त्र (Chemistry)
The functional group that can be identified through phthalein dye test is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2026-C11-070रसायनशास्त्र (Chemistry)
Two products X and Y are formed in the following reaction sequence. Benzene + CH₃Cl —Anhydr. AlCl₃→ W —dil.HNO₃ + dil.H₂SO₄, warm→ X+Y. The suitable method that can be used for the separation of products X and Y is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2026-C11-071रसायनशास्त्र (Chemistry)
Identify the correct statements: A. The molality of 2.5 g of ethanoic acid (Molar mass: 60 g/mol) in 75 g of benzene solution is 0.556 m. B. The molarity of a solution containing 5 g of NaOH (molar mass: 40 g/mol) in 450 mL of solution is 0.278 M at 298 K. C. Aquatic species are more comfortable in cold water. D. The solubility of gas increases with decrease in pressure. E. For a binary mixture of A and B, the number of moles of A and B are nA and nB respectively. The mole fraction of B will be xB = nA/(nA+nB) [as printed in source]. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2026-C11-072रसायनशास्त्र (Chemistry)
During Lassaigne's test, the elements present in an organic compound are converted from

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2026-C11-073रसायनशास्त्र (Chemistry)
A solution of copper sulphate is electrolysed for 10 minutes with a current of 1.5 amperes. The mass of copper deposited at cathode is: (Given : Molar mass of Cu = 63 g mol⁻¹; 1 F = 96487 C mol⁻¹)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2026-C11-074रसायनशास्त्र (Chemistry)
At a certain temperature, T (K), during a process, 500 J is absorbed by the system and work of 200 J is done by the system. Then change in internal energy of the system is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2026-C11-075रसायनशास्त्र (Chemistry)
For a certain reaction R → Product, the plot of concentration [R] vs time has a negative slope as shown (k = −slope). The order of reaction is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2026-C11-076रसायनशास्त्र (Chemistry)
Identify the correct statement about ClF₃ from the following options

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2026-C11-077रसायनशास्त्र (Chemistry)
In a test tube containing a salt, a few drops of dilute H₂SO₄ was added, which gave colourless vapours having the smell of vinegar. The vapours turned the blue litmus paper red. Identify the correct anion from the following

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2026-C11-078रसायनशास्त्र (Chemistry)
At 298 K, a certain buffer solution contains equal concentrations of X⁻ and HX, Kb for X⁻ is 10⁻¹⁰. What is the pH of this buffer solution?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2026-C11-079रसायनशास्त्र (Chemistry)
Calculate emf of the half cell given below : Pt (s) | H₂(g, 2 atm) | HCl (aq, 0.02 M), E°(H2/H+) = 0 V (Given: 2.303RT/F = 0.059, log 2 = 0.3010)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2026-C11-080रसायनशास्त्र (Chemistry)
The calculated 'spin-only' magnetic moment of Ti²⁺ (3d²) is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2026-C11-081रसायनशास्त्र (Chemistry)
Identify the incorrect statement from the following

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2026-C11-082रसायनशास्त्र (Chemistry)
The correct formal charges on oxygen atoms numbered 2, 1 and 3 respectively are

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2026-C11-083रसायनशास्त्र (Chemistry)
Phenolphthalein is used as an indicator for the titration of sodium hydroxide solution against a standard solution of oxalic acid. The colour change that is observed at an alkaline pH close to the equivalence point during this titration is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2026-C11-084रसायनशास्त्र (Chemistry)
When 1 dm³ of CO₂ gas is passed over hot coke the volume of gaseous mixture after complete reaction at STP becomes 1.4 dm³. The composition of the gaseous mixture at STP is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2026-C11-085रसायनशास्त्र (Chemistry)
The major product Z formed in the following sequence of reactions is C₂H₆ →(Cl₂,UV) X(monochlorinated product) →(NH₃) Y →(i.NaNO₂/HCl ii.H₂O) Z.

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2026-C11-086रसायनशास्त्र (Chemistry)
Given below is an expression for the rate constant of a first-order reaction occurring at a certain temperature, T (K). ln k = 14.34 − 1.25×10⁴/T. The energy of activation in kcal mol⁻¹ for the reaction is : (Given: k in s⁻¹, R = 1.987 cal mol⁻¹ K⁻¹)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2026-C11-087रसायनशास्त्र (Chemistry)
Given below are certain reactions. Identify the reaction for which Kp ≠ Kc.

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2026-C11-088रसायनशास्त्र (Chemistry)
Identify the incorrect statement from the following

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2026-C11-089रसायनशास्त्र (Chemistry)
Mixture of chloroform and acetone forms a solution with negative deviation from Raoult's law due to

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
CHM · CHM-2026-C11-090रसायनशास्त्र (Chemistry)
The number of chlorine atoms present in the organic products X and Y of the following reactions, respectively, are : Benzene + 6Cl₂ (Anhydr. AlCl₃, dark/cold) → X; Benzene + 3Cl₂ (UV, 500 K) → Y.

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-002वनस्पतीशास्त्र (Botany)
In a cross between two RrYy individuals, what is the F₂ phenotypic ratio?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-004वनस्पतीशास्त्र (Botany)
During which phase of mitosis do chromosomes align at the equatorial plate?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-005वनस्पतीशास्त्र (Botany)
Where in the chloroplast does the Calvin cycle (light-independent reaction) occur?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2022-CR6-101वनस्पतीशास्त्र (Botany)
Which of the following is not observed during apoplastic pathway ?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2022-CR6-102वनस्पतीशास्त्र (Botany)
The device which can remove particulate matter present in the exhaust from a thermal power plant is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2022-CR6-103वनस्पतीशास्त्र (Botany)
Which one of the following never occurs during mitotic cell division?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2022-CR6-104वनस्पतीशास्त्र (Botany)
Hydrocolloid carrageen is obtained from

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2022-CR6-105वनस्पतीशास्त्र (Botany)
Read the following statements about the vascular bundles : (a) In roots, xylem and phloem in a vascular bundle are arranged in an alternate manner along the different radii. (b) Conjoint closed vascular bundles do not possess cambium (c) In open vascular bundles, cambium is present in between xylem and phloem (d) The vascular bundles of dicotyledonous stem possess endarch protoxylem (e) In monocotyledonous root, usually there are more than six xylem bundles present Choose the correct answer from the options given below
  • A(a), (c), (d) and (e) Only
  • B(a), (b) and (d) Only
  • C(b), (c), (d) and (e) Only
  • D(a), (b), (c) and (d) Only
उत्तर की प्रलंबित — केवळ संदर्भासाठी, गुण दिले जाणार नाहीत

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2022-CR6-106वनस्पतीशास्त्र (Botany)
DNA polymorphism forms the basis of

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2022-CR6-107वनस्पतीशास्त्र (Botany)
Given below are two statements : one is labelled as Assertion (A) and the other is labelled as Reason (R). Assertion (A) : Polymerase chain reaction is used in DNA amplification. Reason (R) : The ampicillin resistant gene is used as a selectable marker to check transformation In the light of the above statements, choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2022-CR6-108वनस्पतीशास्त्र (Botany)
The appearance of recombination nodules on homologous chromosomes during meiosis characterizes

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2022-CR6-109वनस्पतीशास्त्र (Botany)
The flowers are Zygomorphic in: (a) Mustard (b) Gulmohar (c) Cassia (d) Datura (e) Chilly Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2022-CR6-110वनस्पतीशास्त्र (Botany)
Production of Cucumber has increased manifold in recent years. Application of which of the following phytohormones has resulted in this increased yield as the hormone is known to produce female flowers in the plants

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2022-CR6-111वनस्पतीशास्त्र (Botany)
Which one of the following statement is not true regarding gel electrophoresis technique?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2022-CR6-112वनस्पतीशास्त्र (Botany)
In old trees the greater part of secondary xylem is dark brown and resistant to insect attack due to : (a) secretion of secondary metabolities and their deposition in the lumen of vessels. (b) deposition of organic compounds like tannins and resins in the central layers of stem. (c) deposition of suberin and aromatic substances in the outer layer of stem. (d) deposition of tannins, gum, resin and aromatic substances in the peripheral layers of stem. (e) presence of parenchyma cells, functionally active xylem elements and essential oils. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2022-CR6-113वनस्पतीशास्त्र (Botany)
Which of the following is incorrectly matched?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2022-CR6-114वनस्पतीशास्त्र (Botany)
Which one of the following plants does not show plasticity?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2022-CR6-115वनस्पतीशास्त्र (Botany)
Read the following statements and choose the set of correct statements : (a) Euchromatin is loosely packed chromatin (b) Heterochromatin is transcriptionally active (c) Histone octomer is wrapped by negatively charged DNA in nucleosome (d) Histones are rich in lysine and arginine (e) A typical nucleosome contains 400 bp of DNA helix Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2022-CR6-116वनस्पतीशास्त्र (Botany)
Which one of the following produces nitrogen fixing nodules on the roots of Alnus?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2022-CR6-117वनस्पतीशास्त्र (Botany)
Identify the incorrect statement related to Pollination

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2022-CR6-118वनस्पतीशास्त्र (Botany)
Which of the following is not a method of ex situ conservation?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2022-CR6-119वनस्पतीशास्त्र (Botany)
Which one of the following is not true regarding the release of energy during ATP synthesis through chemiosmosis? It involves

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2022-CR6-120वनस्पतीशास्त्र (Botany)
Which one of the following statements cannot be connected to Predation?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2022-CR6-121वनस्पतीशास्त्र (Botany)
Given below are two statements : Statement I : Cleistogamous flowers are invariably autogamous Statement II : Cleistogamy is disadvantageous as there is no chance for cross pollination In the light of the above statements, choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2022-CR6-122वनस्पतीशास्त्र (Botany)
Given below are two statements : Statement I : The primary CO2 acceptor in C4 plants is phosphoenolpyruvate and is found in the mesophyll cells. Statement II : Mesophyll cells of C4 plants lack RuBisCo enzyme. In the light of the above statements, choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2022-CR6-123वनस्पतीशास्त्र (Botany)
Identify the correct set of statements : (a) The leaflets are modified into pointed hard thorns in Citrus and Bougainvillea (b) Axillary buds form slender and spirally coiled tendrils in cucumber and pumpkin (c) Stem is flattened and fleshy in Opuntia and modified to perform the function of leaves (d) Rhizophora shows vertically upward growing roots that help to get oxygen for respiration (e) Subaerially growing stems in grasses and strawberry help in vegetative propagation Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2022-CR6-124वनस्पतीशास्त्र (Botany)
The gaseous plant growth regulator is used in plants to

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2022-CR6-125वनस्पतीशास्त्र (Botany)
Which one of the following plants shows vexillary aestivation and diadelphous stamens?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2022-CR6-126वनस्पतीशास्त्र (Botany)
XO type of sex determination can be found in

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2022-CR6-127वनस्पतीशास्त्र (Botany)
What amount of energy is released from glucose during lactic acid fermentation?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2022-CR6-128वनस्पतीशास्त्र (Botany)
Given below are two statements: Statement I: Decomposition is a process in which the detritus is degraded into simpler substances by microbes. Statement II: Decomposition is faster if the detritus is rich in lignin and chitin. In the light of the above statements, choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2022-CR6-129वनस्पतीशास्त्र (Botany)
What is the net gain of ATP when each molecule of glucose is converted to two molecules of pyruvic acid?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2022-CR6-130वनस्पतीशास्त्र (Botany)
Match List-I with List-II
List IList II
AManganeseIActivates the enzyme catalase
BMagnesiumIIRequired for pollen germination
CBoronIIIActivates enzymes of respiration
DIronIVFunctions in splitting of water during photosynthesis

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2022-CR6-131वनस्पतीशास्त्र (Botany)
Habitat loss and fragmentation, over exploitation, alien species invasion and co-extinction are causes for

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2022-CR6-132वनस्पतीशास्त्र (Botany)
The process of translation of mRNA to proteins begins as soon as

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2022-CR6-133वनस्पतीशास्त्र (Botany)
“Girdling Experiment” was performed by Plant Physiologists to identify the plant tissue through which

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2022-CR6-134वनस्पतीशास्त्र (Botany)
Exoskeleton of arthropods is composed of

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2022-CR6-135वनस्पतीशास्त्र (Botany)
Given below are two statements : Statement I : Mendel studied seven pairs of contrasting traits in pea plants and proposed the Laws of Inheritance. Statement II : Seven characters examined by Mendel in his experiment on pea plants were seed shape and colour, flower colour, pod shape and colour, flower position and stem height. In the light of the above statements, choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2022-CR6-137वनस्पतीशास्त्र (Botany)विभाग B
Addition of more solutes in a given solution will

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2022-CR6-138वनस्पतीशास्त्र (Botany)विभाग B
The anatomy of springwood shows some peculiar features. Identify the correct set of statements about springwood: (a) It is also called as the earlywood, (b) In spring season cambium produces xylem elements with narrow vessels, (c) It is lighter in colour, (d) The springwood along with autumnwood shows alternate concentric rings forming annual rings, (e) It has lower density. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2022-CR6-139वनस्पतीशास्त्र (Botany)विभाग B
Which one of the following will accelerate phosphorus cycle?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2022-CR6-140वनस्पतीशास्त्र (Botany)विभाग B
The entire fleet of buses in Delhi were converted to CNG from diesel. In reference to this, which one of the following statements is false?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2022-CR6-141वनस्पतीशास्त्र (Botany)विभाग B
What is the role of large bundle sheath cells found around the vascular bundles in C4 plants?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2022-CR6-142वनस्पतीशास्त्र (Botany)विभाग B
Which of the following occurs due to the presence of autosome linked dominant trait ?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2022-CR6-143वनस्पतीशास्त्र (Botany)विभाग B
Read the following statements on lipids and find out correct set of statements: (a) Lecithin found in the plasma membrane is a glycolipid, (b) Saturated fatty acids possess one or more c = c bonds, (c) Gingely oil has lower melting point, hence remains as oil in winter, (d) Lipids are generally insoluble in water but soluble in some organic solvents, (e) When fatty acid is esterified with glycerol, monoglycerides are formed. Choose the correct answer from the option given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2022-CR6-144वनस्पतीशास्त्र (Botany)विभाग B
If a geneticist uses the blind approach for sequencing the whole genome of an organism, followed by assignment of function to different segments, the methodology adopted by him is called as

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2022-CR6-145वनस्पतीशास्त्र (Botany)विभाग B
In the following palindromic base sequences of DNA, which one can be cut easily by particular restriction enzyme?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2022-CR6-146वनस्पतीशास्त्र (Botany)विभाग B
Match the plant with the kind of life cycle it exhibits: List I — (a) Spirogyra, (b) Fern, (c) Funaria, (d) Cycas. List II — I. Dominant diploid sporophyte vascular plant, with highly reduced male or female gametophyte, II. Dominant haploid free-living gametophyte, III. Dominant diploid sporophyte alternating with reduced gametophyte called prothallus, IV. Dominant haploid leafy gametophyte alternating with partially dependent multicellular sporophyte. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2022-CR6-147वनस्पतीशास्त्र (Botany)विभाग B
While explaining interspecific interaction of population, (+) sign is assigned for beneficial interaction, (–) sign is assigned for detrimental interaction and (0) for neutral interaction. Which of the following interactions can be assigned (+) for one specifies and (–) for another specifies involved in the interaction ?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2022-CR6-148वनस्पतीशास्त्र (Botany)विभाग B
Transposons can be used during which one of the following ?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2022-CR6-149वनस्पतीशास्त्र (Botany)विभाग B
Match List-I with List-II: List I — (a) Metacentric chromosome, (b) Acrocentric chromosome, (c) Submetacentric, (d) Telocentric chromosome. List II — (i) Centromere situated close to the end forming one extremely short and one very long arms, (ii) Centromere at the terminal end, (iii) Centromere in the middle forming two equal arms of chromosomes, (iv) Centromere slightly away from the middle forming one shorter arm and one longer arm. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2022-CR6-150वनस्पतीशास्त्र (Botany)विभाग B
Given below are two statements : one is labelled as Assertion (A) and the other is labelled as Reason (R). Assertion (A) : Mendel’s law of Independent assortment does not hold good for the genes that are located closely on the same chromosome. Reason (R) : Closely located genes assort independently. In the light of the above statements, choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2023-CG3-103वनस्पतीशास्त्र (Botany)
Upon exposure to UV radiation, DNA stained with ethidium bromide will show

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2023-CG3-105वनस्पतीशास्त्र (Botany)
Among eukaryotes, replication of DNA takes place in

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2023-CG3-106वनस्पतीशास्त्र (Botany)
Spraying of which of the following phytohormone on juvenile conifers helps hastening the maturity period, that leads early seed production?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2023-CG3-107वनस्पतीशास्त्र (Botany)
Given below are two statements: Statement I: The forces generated transpiration can lift a xylem-sized column of water over 130 meters height. Statement II: Transpiration cools leaf surfaces sometimes 10 to 15 degrees evaporative cooling. In the light of the above statements, choose the most appropriate answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2023-CG3-108वनस्पतीशास्त्र (Botany)
The historic Convention on Biological Diversity, 'The Earth Summit' was held in Rio de Janeiro in the year

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2023-CG3-109वनस्पतीशास्त्र (Botany)
Which micronutrient is required for splitting of water molecule during photosynthesis?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2023-CG3-111वनस्पतीशास्त्र (Botany)
Large, colourful, fragrant flowers with nectar are seen in

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2023-CG3-112वनस्पतीशास्त्र (Botany)
Given below are two statements: One labelled as Assertion A and the other labelled as Reason R: Assertion A: The first stage of gametophyte in the life cycle of moss is protonema stage. Reason R: Protonema develops directly from spores produced in capsule. In the light of the above statements, choose the most appropriate answer from options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2023-CG3-114वनस्पतीशास्त्र (Botany)
In angiosperm, the haploid, diploid and triploid structures of a fertilized embryo sac sequentially are

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2023-CG3-116वनस्पतीशास्त्र (Botany)
Given below are two statements: Statement I: Endarch and exarch are the terms often used for describing the position of secondary xylem in the plant body. Statement II: Exarch condition is the most common feature of the root system. In the light of the above statements, choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2023-CG3-117वनस्पतीशास्त्र (Botany)
What is the function of tassels in the corn cob?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2023-CG3-121वनस्पतीशास्त्र (Botany)
Cellulose does not form blue colour with Iodine because

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2023-CG3-122वनस्पतीशास्त्र (Botany)
In the equation GPP − R = NPP, GPP is Gross Primary Productivity, NPP is Net Primary Productivity. R here is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2023-CG3-123वनस्पतीशास्त्र (Botany)
How many ATP and NADPH₂ are required for the synthesis of one molecule of Glucose during Calvin cycle?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2023-CG3-126वनस्पतीशास्त्र (Botany)
Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R: Assertion A: Late wood has fewer xylary elements with narrow vessels. Reason R: Cambium is less active in winters. In the light of the above statements, choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2023-CG3-128वनस्पतीशास्त्र (Botany)
Frequency of recombination between gene pairs on same chromosome as a measure of the distance between genes to map their position on chromosome, was used for the first time by

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2023-CG3-129वनस्पतीशास्त्र (Botany)
The reaction centre in PS II has an absorption maxima at

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2023-CG3-130वनस्पतीशास्त्र (Botany)
Family Fabaceae differs from Solanaceae and Liliaceae. With respect to the stamens, pick out the characteristics specific to family Fabaceae but not found in Solanaceae or Liliaceae.

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2023-CG3-131वनस्पतीशास्त्र (Botany)
In tissue culture experiments, leaf mesophyll cells are put in a culture medium to form callus. This phenomenon may be called as

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2023-CG3-132वनस्पतीशास्त्र (Botany)
Which hormone promotes internode/petiole elongation in deep water rice?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2023-CG3-134वनस्पतीशास्त्र (Botany)
Identify the pair of heterosporous pteridophytes among the following

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2023-CG3-135वनस्पतीशास्त्र (Botany)
Axile placentation is observed in

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2023-CG3-136वनस्पतीशास्त्र (Botany)विभाग B
Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R: Assertion A: A flower is defined as modified shoot wherein the shoot apical meristem changes to floral meristem. Reason R: Internode of the shoot gets condensed to produce different floral appendages laterally at successive node instead of leaves. In the light of the above statements, choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2023-CG3-139वनस्पतीशास्त्र (Botany)विभाग B
Match List I with List II
List IList II
AOxidative decarboxylationICitrate synthase
BGlycolysisIIPyruvate dehydrogenase
COxidative phosphorylationIIIElectron transport system
DTricarboxylic acid cycleIVEMP pathway

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2023-CG3-141वनस्पतीशास्त्र (Botany)विभाग B
Which of the following combinations is required for chemiosmosis?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2023-CG3-142वनस्पतीशास्त्र (Botany)विभाग B
Given below are two statements: One labelled as Assertion A and the other labelled as Reason R: Assertion A: In gymnosperms the pollen grains are released from the microsporangium and carried by air currents. Reason R: Air currents carry the pollen grains to the mouth of the archegonia where the male gametes are discharged and pollen tube is not formed. In the light of the above statements, choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2023-CG3-145वनस्पतीशास्त्र (Botany)विभाग B
Identify the correct statements: A. Lenticels are the lens-shaped openings permitting the exchange of gases. B. Bark formed early in the season is called hard bark. C. Bark is a technical term that refers to all tissues exterior to vascular cambium. D. Bark refers to periderm and secondary phloem. E. Phellogen is single-layered in thickness. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2023-CG3-147वनस्पतीशास्त्र (Botany)विभाग B
Match List I with List II
List I (Interaction)List II (Species A and B)
AMutualismI+(A), 0(B)
BCommensalismII−(A), 0(B)
CAmensalismIII+(A), −(B)
DParasitismIV+(A), +(B)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2023-CG3-148वनस्पतीशास्त्र (Botany)विभाग B
Match List I with List II
List IList II
ACohesionIMore attraction in liquid phase
BAdhesionIIMutual attraction among water molecules
CSurface tensionIIIWater loss in liquid phase
DGuttationIVAttraction towards polar surfaces

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2023-CG3-150वनस्पतीशास्त्र (Botany)विभाग B
Match List I with List II
List IList II
AIronISynthesis of auxin
BZincIIComponent of nitrate reductase
CBoronIIIActivator of catalase
DMolybdenumIVCell elongation and differentiation

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2023-CG3-157वनस्पतीशास्त्र (Botany)
Given below are two statements: Statement I: RNA mutates at a faster rate. Statement II: Viruses having RNA genome and shorter life span mutate and evolve faster. In the light of the above statements, choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2023-CG3-161वनस्पतीशास्त्र (Botany)
Which of the following are NOT considered as the part of endomembrane system? A. Mitochondria B. Endoplasmic reticulum C. Chloroplasts D. Golgi complex E. Peroxisomes. Choose the most appropriate answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2023-CG3-166वनस्पतीशास्त्र (Botany)
Which of the following statements is correct?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2023-CG3-167वनस्पतीशास्त्र (Botany)
Match List I with List II
List I (Interacting species)List II (Name of interaction)
AA Leopard and a Lion in a forest/grasslandICompetition
BA Cuckoo laying egg in a Crow's nestIIBrood parasitism
CFungi and root of a higher plant in MycorrhizaeIIIMutualism
DA cattle egret and a Cattle in a fieldIVCommensalism

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2023-CG3-170वनस्पतीशास्त्र (Botany)
Given below are two statements: Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid. Statement II: In eukaryotes, the negatively charged DNA is wrapped around the positively charged histone octamer to form nucleosome. In the light of the above statements, choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2023-CG3-173वनस्पतीशास्त्र (Botany)
Which one of the following techniques does not serve the purpose of early diagnosis of a disease for its early treatment?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2023-CG3-176वनस्पतीशास्त्र (Botany)
Given below are two statements: Statement I: Electrostatic precipitator is most widely used in thermal power plant. Statement II: Electrostatic precipitator in thermal power plant removes ionising radiations. In the light of the above statements, choose the most appropriate answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2023-CG3-179वनस्पतीशास्त्र (Botany)
Given below are two statements: Statement I: Low temperature preserves the enzyme in a temporarily inactive state whereas high temperature destroys enzymatic activity because proteins are denatured by heat. Statement II: When the inhibitor closely resembles the substrate in its molecular structure and inhibits the activity of the enzyme, it is known as competitive inhibitor. In the light of the above statements, choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2023-CG3-189वनस्पतीशास्त्र (Botany)विभाग B
Match List I with List II
List IList II
ALogistic growthIUnlimited resource availability condition
BExponential growthIILimited resource availability condition
CExpanding age pyramidIIIThe percent individuals of pre-reproductive age is largest followed by reproductive and post reproductive age groups
DStable age pyramidIVThe percent individuals of pre-reproductives and reproductive age group are same

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2023-CG3-191वनस्पतीशास्त्र (Botany)विभाग B
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5'AUCGAUCGAUCGAUCGAUCGAUCG AUCG 3'?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2023-CG3-195वनस्पतीशास्त्र (Botany)विभाग B
Which one of the following is NOT an advantage of inbreeding?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2024-CT3-101वनस्पतीशास्त्र (Botany)
Identify the set of correct statements: A. The flowers of Vallisneria are colourful and produce nectar B. The flowers of waterlily are not pollinated by water. C. In most of water-pollinated species, the pollen grains are protected from wetting. D. Pollen grains of some hydrophytes are long and ribbon like. E. In some hydrophytes, the pollen grains are carried passively inside water. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2024-CT3-102वनस्पतीशास्त्र (Botany)
The type of conservation in which the threatened species are taken out from their natural habitat and placed in special setting where they can be protected and given special care is called;

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2024-CT3-103वनस्पतीशास्त्र (Botany)
Inhibition of Succinic dehydrogenase enzyme by malonate is a classical example of

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2024-CT3-104वनस्पतीशास्त्र (Botany)
Identify the part of the seed from the given figure which is destined to form root when the seed germinates.

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2024-CT3-105वनस्पतीशास्त्र (Botany)
Bulliform cells are responsible for

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2024-CT3-106वनस्पतीशास्त्र (Botany)
Which of the following are required for the dark reaction of photosynthesis? A. Light B. Chlorophyll C. CO2 D. ATP E. NADPH Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2024-CT3-107वनस्पतीशास्त्र (Botany)
Formation of interfascicular cambium from fully developed parenchyma cells is an example for

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2024-CT3-108वनस्पतीशास्त्र (Botany)
Hind II always cuts DNA molecules at a particular point called recognition sequence and it consists of

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2024-CT3-109वनस्पतीशास्त्र (Botany)
Tropical regions show greatest level of species richness because A. Tropical latitudes have remained relatively undisturbed for milions of years, hence more time was available for species diversification. B. Tropical environments are more seasonal. C. More solar energy is available in tropics. D. Constant environments promote niche specialization. E. Tropical environments are constant and predictable. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2024-CT3-110वनस्पतीशास्त्र (Botany)
Which one of the following is not a criterion for classification of fungi?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2024-CT3-111वनस्पतीशास्त्र (Botany)
How many molecules of ATP and NADPH are required for every molecule of CO2 fixed in the Calvin cycle?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2024-CT3-112वनस्पतीशास्त्र (Botany)
These are regarded as major causes of biodiversity loss: A. Over exploitation B. Co-extinction C. Mutation D. Habitat loss and fragmentation E. Migration Choose the correct option

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2024-CT3-113वनस्पतीशास्त्र (Botany)
The capacity to generate a whole plant from any cell of the plant is called

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2024-CT3-114वनस्पतीशास्त्र (Botany)
The equation of Verhulst-Pearl logistic growth is dN/dt = rN(K−N)/K. From this equation, K indicates

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2024-CT3-115वनस्पतीशास्त्र (Botany)
Spindle fibers attach to kinetochores of chromosomes during

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2024-CT3-116वनस्पतीशास्त्र (Botany)
Identify the type of flowers based on the position of calyx, corolla and androecium with respect to the ovary from the given figures (a) and (b) (figure-dependent: two flower diagrams (a) and (b) showing the position of floral parts relative to the ovary)
  • A(a) Perigynous; (b) Epigynous
  • B(a) Perigynous; (b) Perigynous
  • C(a) Epigynous; (b) Hypogynous
  • D(a) Hypogynous; (b) Epigynous
उत्तर की प्रलंबित — केवळ संदर्भासाठी, गुण दिले जाणार नाहीत

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2024-CT3-117वनस्पतीशास्त्र (Botany)
Match List I with List II
List IList II
ARhizopusIMushroom
BUstilagoIISmut fungus
CPucciniaIIIBread mould
DAgaricusIVRust fungus

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2024-CT3-118वनस्पतीशास्त्र (Botany)
In a plant, black seed color (BB/Bb) is dominant over white seed color (bb). In order to find out the genotype of the black seed plant, with which of the following genotype will you cross it?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2024-CT3-119वनस्पतीशास्त्र (Botany)
A pink flowered Snapdragon plant was crossed with a red flowered Snapdragon plant. What type of phenotype/s is/are expected in the progeny?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2024-CT3-120वनस्पतीशास्त्र (Botany)
Match List I with List II
List IList II
ATwo or more alternative forms of a geneIBack cross
BCross of F1 progeny with homozygous recessive parentIIPloidy
CCross of F1 progeny with any of the parentsIIIAllele
DNumber of chromosome sets in plantIVTest cross

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2024-CT3-121वनस्पतीशास्त्र (Botany)
Lecithin, a small molecular weight organic compound found in living tissues, is an example of

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2024-CT3-122वनस्पतीशास्त्र (Botany)
Match List I with List II
List IList II
AClostridium butylicumIEthanol
BSaccharomyces cerevisiaeIIStreptokinase
CTrichoderma polysporumIIIButyric acid
DStreptococcus sp.IVCyclosporin-A

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2024-CT3-123वनस्पतीशास्त्र (Botany)
In the given figure, which component has thin outer walls and highly thickened inner walls (figure-dependent: labeled anatomical cross-section diagram with components A, B, C, D)
  • AA
  • BB
  • CC
  • DD
उत्तर की प्रलंबित — केवळ संदर्भासाठी, गुण दिले जाणार नाहीत

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2024-CT3-124वनस्पतीशास्त्र (Botany)
Which of the following is an example of actinomorphic flower?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2024-CT3-125वनस्पतीशास्त्र (Botany)
A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end;

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2024-CT3-126वनस्पतीशास्त्र (Botany)
What is the fate of piece of DNA carrying only gene of interest which is transferred into an alien organism? A. The piece of DNA would be able to multiply itself independently in the progeny cells of the organisms. B. It may get integrated into the genome of the recipient. C. It may multiply and be inherited along with the host DNA. D. The alien piece of DNA is not an integrated part of chromosome. E. It shows ability to replicate. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2024-CT3-127वनस्पतीशास्त्र (Botany)
Auxin is used by gardeners to prepare weed free lawns. But no damage is caused to grass as auxin;

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2024-CT3-128वनस्पतीशास्त्र (Botany)
The cofactor of the enzyme carboxypeptidase is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2024-CT3-129वनस्पतीशास्त्र (Botany)
The lactose present in the growth medium of bacteria is transported to the cell by the action of

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2024-CT3-130वनस्पतीशास्त्र (Botany)
Which one of the following can be explained on the basis of Mendel's Law of Dominance? A. Out of one pair of factors one is dominant and the other is recessive. B. Alleles do not show any expression and both the characters appear as such in F2 generation. C. Factors occur in pair in normal diploid plants. D. The discrete unit controlling a particular character is called factor. E. The expression of only one of the parental characters is found in a monohybrid cross. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2024-CT3-131वनस्पतीशास्त्र (Botany)
Given below are two statements: Statement I: Bt toxins are insect group specific and coded by a gene cry IAc. Statement II: Bt toxin exists as inactive protoxin in B. thuringiensis. However, after ingestion by the insect the inactive protoxin gets converted into active form due to acidic pH of the insect gut. In the light of the above statements, choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2024-CT3-132वनस्पतीशास्त्र (Botany)
Given below are two statements: Statement I: Parenchyma is living but collenchyma is dead tissue. Statement II: Gymnosperms lack xylem vessels but presence of xylem vessels is the characteristic of angiosperms. In the light of the above statements, choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2024-CT3-133वनस्पतीशास्त्र (Botany)
Given below are two Statements: Statement I : Chromosomes become gradually visible under light microscope during leptotene stage. Statement II: The beginning of diplotene stage is recognized by dissolution of synaptonemal complex. In the light of the above statements, choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2024-CT3-137वनस्पतीशास्त्र (Botany)विभाग B
Which of the following are fused in somatic hybridization involving two varieties of plants?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2024-CT3-139वनस्पतीशास्त्र (Botany)विभाग B
Spraying sugarcane crop with which of the following plant growth regulators, increases the length of stem, thus, increasing the yield?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2024-CT3-140वनस्पतीशास्त्र (Botany)विभाग B
Match List-I with List-II
List IList II
AFrederick GriffithIGenetic code
BFrancois Jacob & Jacques MonodIISemi-conservative mode of DNA replication
CHar Gobind KhoranaIIITransformation
DMeselson & StahlIVLac operon

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2024-CT3-141वनस्पतीशास्त्र (Botany)विभाग B
Match List-I with List-II
List IList II
AGLUT-4IHormone
BInsulinIIEnzyme
CTrypsinIIIIntercellular ground substances
DCollagenIVEnables glucose transport into cell

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2024-CT3-142वनस्पतीशास्त्र (Botany)विभाग B
Given below are two statements: Statement I : In C3 Plants, some O2 binds RuBisCO, hence CO2 fixation is decreased. Statement II: In C4 plants, mesophyll cells show very little photorespiration while bundle sheath cells do not show photorespiration. In the light of the above statements, choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2024-CT3-143वनस्पतीशास्त्र (Botany)विभाग B
Identify the step in tricarboxylic acid cycle, which does not involve oxidation of substrate.

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2024-CT3-144वनस्पतीशास्त्र (Botany)विभाग B
Match List-I with List-II
List IList II
ACitric acid cycleICytoplasm
BGlycolysisIIMitochondrial matrix
CElectron transport systemIIIIntermembrane space of mitochondria
DProton gradientIVInner mitochondrial membrane

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2024-CT3-145वनस्पतीशास्त्र (Botany)विभाग B
Which of the following statement is correct regarding the process of replication in E.coli ?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2024-CT3-146वनस्पतीशास्त्र (Botany)विभाग B
In an ecosystem if the Net Primary Productivity (NPP) of first trophic level is: (100x kcalm−2 yr−1) what would be the GPP (Gross Primary Productivity) of the third trophic level of the same ecosystem?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2024-CT3-147वनस्पतीशास्त्र (Botany)विभाग B
Match List-I with List-II
List IList II
ARoseITwisted aestivation
BPeaIIPerigynous flower
CCottonIIIDrupe
DMangoIVMarginal placentation

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2024-CT3-148वनस्पतीशास्त्र (Botany)विभाग B
Match List-I with List-II
List IList II
ARobert MayISpecies area relationship
BAlexander von HumboldtIILong term ecosystem experiment using out door plots
CPaul EhrlichIIIGlobal species diversity at about 7 million
DDavid TilmanIVRivet popper hypothesis

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2024-CT3-149वनस्पतीशास्त्र (Botany)विभाग B
Match List-I with List-II
List IList II
AMonoadelphousICitrus
BDiadelphousIIPea
CPolyadelphousIIILily
DEpiphyllousIVChina-rose

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2024-CT3-150वनस्पतीशास्त्र (Botany)विभाग B
Read the following statements and choose the set of correct statements. In the members of Phaeophyceae. A. Asexual reproduction occurs usually by biflagellate zoospores. B. Sexual reproduction is by oogamous method only. C. Stored food is in the form of carbohydrates which is either mannitol or laminarin D. The major pigments found are chlorophyll a, c and carotenoids and xanthophyll. E. Vegetative cells have a cellulosic wall, usually covered on the outside by gelatinous coating of algin. Choose the correct answer front the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2025-C45-091वनस्पतीशास्त्र (Botany)
The complex II of mitochondrial electron transport chain is also known as

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2025-C45-092वनस्पतीशास्त्र (Botany)
Polymerase chain reaction (PCR) amplifies DNA following the equation.

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2025-C45-095वनस्पतीशास्त्र (Botany)
Which one of the following statements refers to Reductionist Biology?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2025-C45-096वनस्पतीशास्त्र (Botany)
Given below are two statements: Statement I: In the RNA world, RNA is considered the first genetic material evolved to carry out essential life processes. RNA acts as a genetic material and also as a catalyst for some important biochemical reactions in living systems. Being reactive, RNA is unstable. Statement II: DNA evolved from RNA and is a more stable genetic material. Its double helical strands being complementary, resist changes by evolving repairing mechanism. In the light of the above statements, choose the most appropriate answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2025-C45-097वनस्पतीशास्त्र (Botany)
Epiphytes that are growing on a mango branch is an example of which of the following?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2025-C45-099वनस्पतीशास्त्र (Botany)
Which one of the following is an example of ex-situ conservation?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2025-C45-100वनस्पतीशास्त्र (Botany)
Given below are two statements: Statement I: The primary source of energy in an ecosystem is solar energy. Statement II: The rate of production of organic matter during photosynthesis in an ecosystem is called net primary productivity (NPP). In the light of the above statements, choose the most appropriate answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2025-C45-102वनस्पतीशास्त्र (Botany)
Given below are two statement: One is labelled as Assertion (A) and the other is labelled as Reason (R). Assertion (A): Both wind and water pollinated flowers are not very colourful and do not produce nectar. Reason (R): The flowers produce enormous amount of pollen grains in wind and water pollinated flowers. In the light of the above statements, choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2025-C45-104वनस्पतीशास्त्र (Botany)
Given below are two statements: Statement I: In a floral formula ⊕ stands for zygomorphic nature of the flower, and G stands for inferior ovary. Statement II: In a floral formula ⊕ stands for actinomorphic nature of the flower and G stands for superior ovary. In the light of the above statements, choose the most appropriate answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2025-C45-108वनस्पतीशास्त्र (Botany)
Which one of the following phytohormones promotes nutrient mobilization which helps in the delay of leaf senescence in plants?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2025-C45-111वनस्पतीशास्त्र (Botany)
Given below are the stages in the life cycle of pteridophytes. Arrange the following stages in the correct sequence. A. Prothallus stage B. Meiosis in spore mother cells C. Fertilisation D. Formation of archegonia and antheridia in gametophyte. E. Transfer of antherozoids to the archegonia in presence of water. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2025-C45-113वनस्पतीशास्त्र (Botany)
Which of following organisms cannot fix nitrogen? A. Azotobacter B. Oscillatoria C. Anabaena D. Volvox E. Nostoc. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2025-C45-116वनस्पतीशास्त्र (Botany)
Which of the following genetically engineered organisms was used by Eli Lilly to prepare human insulin?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2025-C45-118वनस्पतीशास्त्र (Botany)
Find the statement that is NOT correct with regard to the structure of monocot stem.

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2025-C45-119वनस्पतीशास्त्र (Botany)
The correct sequence of events in the life cycle of bryophytes is A. Fusion of antherozoid with egg. B. Attachment of gametophyte to substratum. C. Reduction division to produce haploid spores. D. Formation of sporophyte. E. Release of antherozoids into water. Choose the correct answer from the option given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2025-C45-121वनस्पतीशास्त्र (Botany)
Match List-I with List-II
List IList II
ACentromereIMitochondrion
BCiliumIICell division
CCristaeIIICell movement
DCell membraneIVPhospholipid Bilayer

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2025-C45-122वनस्पतीशास्त्र (Botany)
Match List-I with List-II
List IList II
AChlorophyll aIYellow-green
BChlorophyll bIIYellow
CXanthophyllsIIIBlue-green
DCarotenoidsIVYellow to Yellow-orange

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2025-C45-124वनस्पतीशास्त्र (Botany)
In the seeds of cereals, the outer covering of endosperm separates the embryo by a protein-rich layer called

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2025-C45-127वनस्पतीशास्त्र (Botany)
Given below are two statements: One is labelled as Assertion (A) and the other is labelled as Reason (R). Assertion (A): A typical unfertilized, angiosperm embryo sac at maturity is 8 nucleate and 7-celled. Reason (R): The egg apparatus has 2 polar nuclei. In the light of the above statements, choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2025-C45-129वनस्पतीशास्त्र (Botany)
Which of the following are the post-transcriptional events in an eukaryotic cell? A. Transport of pre-mRNA to cytoplasm prior to splicing. B. Removal of introns and joining of exons. C. Addition of methyl group at 5' end of hnRNA. D. Addition of adenine residues at 3' end of hnRNA. E. Base pairing of two complementary RNAs. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2025-C45-131वनस्पतीशास्त्र (Botany)
Which one of the following enzymes contains 'Haem' as the prosthetic group?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2025-C45-133वनस्पतीशास्त्र (Botany)
Who is known as the father of Ecology in India?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2025-C45-140वनस्पतीशास्त्र (Botany)
Given below are two statements: one is labelled as Assertion (A) and the other is labelled as Reason (R). Assertion (A): The primary function of the Golgi apparatus is to package the materials made by the endoplasmic reticulum and deliver it to intracellular targets and outside the cell. Reason (R): Vesicles containing materials made by the endoplasmic reticulum fuse with the cis face of the Golgi apparatus, and they are modified and released from the trans face of the Golgi apparatus. In the light of the above statements, choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2025-C45-141वनस्पतीशास्त्र (Botany)
Match List I with List II
List IList II
AScutellumIPersistent nucellus
BNon-albuminous seedIICotyledon of Monocot seed
CEpiblastIIIGroundnut
DPerispermIVRudimentary cotyledon

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2025-C45-144वनस्पतीशास्त्र (Botany)
Silencing of specific mRNA is possible via RNAi because of -

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2025-C45-145वनस्पतीशास्त्र (Botany)
Genes R and Y follow independent assortment. If RRYY produce round yellow seeds and rryy produce wrinkled green seeds, what will be the phenotypic ratio of the F2 generation?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2025-C45-149वनस्पतीशास्त्र (Botany)
The protein portion of an enzyme is called

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2025-C45-150वनस्पतीशास्त्र (Botany)
Which of the following is the unit of productivity of an Ecosystem?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2025-C45-151वनस्पतीशास्त्र (Botany)
Sweet potato and potato represent a certain type of evolution. Select the correct combination of terms to explain the evolution.

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2025-C45-153वनस्पतीशास्त्र (Botany)
Given below are two statements: one is labelled as Assertion (A) and the other is labelled as Reason (R). Assertion (A): Cells of the tapetum possess dense cytoplasm and generally have more than one nucleus. Reason (R): Presence of more than one nucleus in the tapetum increases the efficiency of nourishing the developing microspore mother cells. In the light of the above statements, choose the most appropriate answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2025-C45-154वनस्पतीशास्त्र (Botany)
How many meiotic and mitotic divisions need to occur for the development of a mature female gametophyte from the megaspore mother cell in an angiosperm plant?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2025-C45-155वनस्पतीशास्त्र (Botany)
Which of the following is an example of a zygomorphic flower?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2025-C45-157वनस्पतीशास्त्र (Botany)
Given below are two statements: Statement I: Fig fruit is a non-vegetarian fruit as it has enclosed fig wasps in it. Statement II: Fig wasp and fig tree exhibit mutual relationship as fig wasp completes its life cycle in fig fruit and fig fruit gets pollinated by fig wasp. In the light of the above statements, choose the most appropriate answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2025-C45-159वनस्पतीशास्त्र (Botany)
Which one of the following is the characteristic feature of gymnosperms?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2025-C45-162वनस्पतीशास्त्र (Botany)
Match List-I with List-II
List IList II
APteridophyteISalvia
BBryophyteIIGinkgo
CAngiospermIIIPolytrichum
DGymnospermIVSalvinia

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2025-C45-164वनस्पतीशास्त्र (Botany)
Match List-I with List-II
List IList II
AThe Evil QuartetICryopreservation
BEx situ conservationIIAlien species invasion
CLantana camaraIIICauses of biodiversity losses
DDodoIVExtinction

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2025-C45-168वनस्पतीशास्त्र (Botany)
In bryophytes, the gemmae help in which one of the following?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2025-C45-171वनस्पतीशास्त्र (Botany)
Which of the following statements about RuBisCO is true?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2025-C45-173वनस्पतीशास्त्र (Botany)
Read the following statements on plant growth and development. A. Parthenocarpy can be induced by auxins. B. Plant growth regulators can be involved in promotion as well as inhibition of growth. C. Dedifferentiation is a pre-requisite for re-differentiation. D. Abscisic acid is a plant growth promoter. E. Apical dominance promotes the growth of lateral buds. Choose the option with all correct statements.

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2025-C45-177वनस्पतीशास्त्र (Botany)
Which of the following microbes is NOT involved in the preparation of household products? A. Aspergillus niger B. Lactobacillus C. Trichoderma polysporum D. Saccharomyces cerevisiae E. Propionibacterium sharmanii. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2025-C45-179वनस्पतीशास्त्र (Botany)
The blue and white selectable markers have been developed which differentiate recombinant colonies from non-recombinant colonies on the basis of their ability to produce colour in the presence of a chromogenic substrate. Given below are two statements about this method: Statement I: The blue coloured colonies have DNA insert in the plasmid and they are identified as recombinant colonies. Statement II: The colonies without blue colour have DNA insert in the plasmid and are identified as recombinant colonies. In the light of the above statements, choose the most appropriate answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2026-C11-091वनस्पतीशास्त्र (Botany)
In angiosperms, root hairs arise from which one of the following regions of the root?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2026-C11-092वनस्पतीशास्त्र (Botany)
In which one of the following, the ovules are not enclosed by an ovary wall and remain exposed?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2026-C11-094वनस्पतीशास्त्र (Botany)
Exploring molecular, genetic and species-level diversity for products of economic importance is called

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2026-C11-096वनस्पतीशास्त्र (Botany)
Match List I with List II
List IList II
AProductivityIGross primary productivity minus respiration losses
BNet primary productivityIIRate of formation of new organic matter by consumers
CGross primary productivityIIIRate of biomass production
DSecondary productivityIVRate of production of organic matter during photosynthesis

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2026-C11-099वनस्पतीशास्त्र (Botany)
The main function of bulliform cells in grasses is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2026-C11-102वनस्पतीशास्त्र (Botany)
Which of the following statements are correct? A. The Amazon rainforest being cut and cleared for cultivation of soyabeans is an example of habitat loss. B. Steller's sea cow and passenger pigeon became extinct due to over-exploitation by humans. C. The Nile perch introduced into Lake Victoria in East Africa helped population growth of cichlid fish in the lake. D. Water hyacinth is an invasive species. E. When a species becomes extinct, the plant and animal species associated with it are not affected. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2026-C11-104वनस्पतीशास्त्र (Botany)
Which one of the following statements is not true about the universal rules of binomial nomenclature?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2026-C11-105वनस्पतीशास्त्र (Botany)
Match List I with List II
List IList II
ADecompositionIAccumulation of dark coloured amorphous substance
BDetritusIIRelease of inorganic nutrients by the activity of microbes in soil
CMineralisationIIIBreaking down of complex organic matter into inorganic substances
DHumificationIVDead remains of plants and animals including fecal matter

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2026-C11-107वनस्पतीशास्त्र (Botany)
2(C₅₁H₉₈O₆) + 145 O₂ → 102 CO₂ + 98 H₂O + energy. The Respiratory Quotient (RQ) of a biomolecule used for respiration, as per the above equation would be

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2026-C11-111वनस्पतीशास्त्र (Botany)
Find the incorrect statement(s) about photosynthesis from the following: A. The water splitting complex is associated with PS I. B. C4 plants use the C3 pathway as the main biosynthetic pathway of CO2 fixation. C. In C4 plants, photorespiration does not occur. D. C3 plants exhibit 'Kranz' anatomy. E. ATP synthesis in chloroplast occurs through chemiosmosis. Choose the answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2026-C11-112वनस्पतीशास्त्र (Botany)
Arrange the following steps of somatic hybridisation in a correct sequence. A. Digestion of cell walls. B. Isolation of naked protoplasts. C. Fusion of protoplasts to get hybrid protoplast. D. Isolation of single cells from two different varieites of plants. E. Growing of hybrid protoplast to form a new plant. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2026-C11-113वनस्पतीशास्त्र (Botany)
Match List I with List II
List IList II
AConjunctive tissueISpecialised cells in the vicinity of guard cells
BCasparian stripsIIEndodermal cells rich in starch
CSubsidiary cellsIIITissue between xylem and phloem
DStarch sheathIVEndodermal cells with suberin deposition

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2026-C11-114वनस्पतीशास्त्र (Botany)
Which one of the following is not a characteristic of plant cells in the phase of elongation?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2026-C11-115वनस्पतीशास्त्र (Botany)
Match List I with List II
List I (Growth Regulator)List II (Function/Effect)
A2,4-DIBrewing industry
BGA3IIStimulation of stomatal closure
CKinetinIIIHerbicide
DABAIVNutrient mobilisation

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2026-C11-116वनस्पतीशास्त्र (Botany)
The enzyme required for carboxylation in the Calvin cycle is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2026-C11-117वनस्पतीशास्त्र (Botany)
How many ATP and NADPH molecules are required to make one molecule of glucose through the Calvin pathway?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2026-C11-119वनस्पतीशास्त्र (Botany)
Which of the following is an in situ conservation method?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2026-C11-121वनस्पतीशास्त्र (Botany)
In racemose inflorescence, _________.

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2026-C11-122वनस्पतीशास्त्र (Botany)
Arrange the following in the correct developmental sequence related to microsporogenesis: A. Microspore tetrads, B. Sporogenous tissue, C. Pollen grains, D. Pollen mother cells. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2026-C11-125वनस्पतीशास्त्र (Botany)
Heterophyllous development in response to environment is an example of which of the following phenomena?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2026-C11-127वनस्पतीशास्त्र (Botany)
"The Evil Quartet" of biodiversity loss includes which of the following?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2026-C11-129वनस्पतीशास्त्र (Botany)
Which one of the following is a triploid cell?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2026-C11-130वनस्पतीशास्त्र (Botany)
Which one of the following types of pollination brings genetically different types of pollen grains to the stigma?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2026-C11-131वनस्पतीशास्त्र (Botany)
Match List I with List II
List I (Placentation)List II (Example)
AMarginalIMustard
BAxileIIPea
CParietalIIIMarigold
DBasalIVLemon

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2026-C11-132वनस्पतीशास्त्र (Botany)
The main criteria used for Five Kingdom Classification proposed By R.H. Whittaker (1969) included: A. Cell structure, B. Body organization, C. Presence of flagellum, D. Reproduction, E. Phylogenetic relationships. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2026-C11-134वनस्पतीशास्त्र (Botany)
Which of the following statements are correct with respect to DNA separation, isolation and visualization? A. The cutting of DNA is done by molecular scissors. B. The DNA fragments separate according to their size in an agarose gel, upon electrophoresis. C. The separated DNA fragments can be seen without staining when exposed to UV light. D. The separated DNA fragments, when stained with ethidium bromide, can be seen in visible light. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2026-C11-139वनस्पतीशास्त्र (Botany)
The following are the stages of life cycle of Plasmodium. Arrange the stages in the proper order. A. The parasites reproduce asexually in RBCs, bursting the cells. B. The parasites reproduce asexually in liver cells, bursting the cells and releasing into blood. C. Gametocytes develop in RBCs. D. Sporozoites reach the liver through the blood. E. Female mosquito injects sporozoites into humans during bite. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2026-C11-145वनस्पतीशास्त्र (Botany)
Which of the following is not an example of convergent evolution?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2026-C11-152वनस्पतीशास्त्र (Botany)
The human protein named α-1-antitrypsin, obtained from transgenic animals, is used for the treatment of ________.

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2026-C11-155वनस्पतीशास्त्र (Botany)
Non-membrane bound cell organelles found in both prokaryotic and eukaryotic cells are ______.

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2026-C11-158वनस्पतीशास्त्र (Botany)
Match List I with List II
List I (Bioactive molecules)List II (Importance)
AStreptokinaseIImmunosuppressive agent
BStatinsIIRemoval of clots from the blood vessels
CLipasesIIIBlood cholesterol-lowering agent
DCyclosporin AIVDetergent formulations

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2026-C11-172वनस्पतीशास्त्र (Botany)
The toxin proteins isolated from Bacillus thuringiensis, coded by which of the following genes would control cotton bollworms and corn borer, respectively?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2026-C11-175वनस्पतीशास्त्र (Botany)
Choose the correct statements regarding cell organelles and their inclusions. A. The endomembrane system includes Golgi complex, endoplasmic reticulum and mitochondria. B. Rough endoplasmic reticulum bears ribosomes on its surface. C. Both mitochondria and plastids have circular DNA. D. A network of microtubules, microfilaments and intermediate filaments present in the cytoplasm is called cytoskeleton. E. Mitochondrion is a single membrane-bound structure. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
BOT · BIO-2026-C11-176वनस्पतीशास्त्र (Botany)
Select the correct statements regarding cell membrane in eukaryotic cell. A. Membrane of human RBCs has approximately 52% protein. B. Major phospholipids are arranged in a bilayer. C. Extensions of the plasma membrane into the cell form mesosomes. D. Tails towards the inner part of lipids are hydrophobic and thus protected from aqueous medium. E. Glycocalyx is present on the outer surface of the plasma membrane. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-001प्राणीशास्त्र (Zoology)
Which is the correct path of blood leaving the right side of the heart?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-003प्राणीशास्त्र (Zoology)
What is the functional unit of the kidney?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2022-CR6-151प्राणीशास्त्र (Zoology)
Which of the following statements with respect to Endoplasmic Reticulum is incorrect?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2022-CR6-152प्राणीशास्त्र (Zoology)
Regarding Meiosis, which of the statements is incorrect?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2022-CR6-153प्राणीशास्त्र (Zoology)
Given below are two statements : Statement I : The coagulum is formed of network of threads called thrombins. Statement II : Spleen is the graveyard of erythrocytes. In the light of the above statements, choose the most appropriate answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2022-CR6-154प्राणीशास्त्र (Zoology)
Given below are two statements: Statement I: Restriction endonucleases recognise specific sequence to cut DNA known as palindromic nucleotide sequence. Statement II: Restriction endonucleases cut the DNA strand a little away from the centre of the palindromic site. In the light of the above statements, choose the most appropriate answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2022-CR6-155प्राणीशास्त्र (Zoology)
Identify the asexual reproductive structure associated with Penicillium

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2022-CR6-156प्राणीशास्त्र (Zoology)
Nitrogenous waste is excreted in the form of pellet or paste by

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2022-CR6-157प्राणीशास्त्र (Zoology)
Which of the following is present between the adjacent bones of the vertebral column?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2022-CR6-158प्राणीशास्त्र (Zoology)
Given below are two statements : one is labelled as Assertion (A) and the other is labelled as Reason (R). Assertion (A) : All vertebrates are chordates but all chordates are not vertebrates. Reason (R) : Notochord is replaced by vertebral column in the adult vertebrates. In the light of the above statements, choose the most appropriate answer from the option given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2022-CR6-159प्राणीशास्त्र (Zoology)
Lippe’s loop is a type of contraceptive used as

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2022-CR6-160प्राणीशास्त्र (Zoology)
At which stage of life the oogenesis process is initiated?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2022-CR6-161प्राणीशास्त्र (Zoology)
Which of the following is not a connective tissue?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2022-CR6-162प्राणीशास्त्र (Zoology)
Given below are two statements : one is labelled as Assertion (A) and the other is labelled as Reason (R). Assertion (A): Osteoporosis is characterised by decreased bone mass and increased chance of fractures. Reason (R): Common cause of osteoporosis is increased levels of estrogen. In the light of the above statements, choose the most appropriate answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2022-CR6-163प्राणीशास्त्र (Zoology)
Which of the following statements are true for spermatogenesis but do not hold true for Oogenesis? (a) It results in the formation of haploid gametes (b) Differentiation of gamete occurs after the completion of meiosis (c) Meiosis occurs continuously in a mitotically dividing stem cell population (d) It is controlled by the Luteinising hormone (LH) and Follicle Stimulating Hormone (FSH) secreted by the anterior pituitary (e) It is initiated at puberty: Choose the most appropriate answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2022-CR6-164प्राणीशास्त्र (Zoology)
A dehydration reaction links two glucose molecules to product maltose. If the formula for glucose is C 6H12O6 then what is the formula for maltose?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2022-CR6-165प्राणीशास्त्र (Zoology)
Breeding crops with higher levels of vitamins and minerals or higher proteins and healthier fats is called

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2022-CR6-166प्राणीशास्त्र (Zoology)
Identify the microorganism which is responsible for the production of an immunosuppressive molecule cyclosporin A

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2022-CR6-167प्राणीशास्त्र (Zoology)
Tegmina in cockroach, arises from

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2022-CR6-168प्राणीशास्त्र (Zoology)
Detritivores breakdown detritus into smaller particles. This process is called

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2022-CR6-169प्राणीशास्त्र (Zoology)
If ‘8’ Drosophila in a laboratory population of ‘80’ died during a week, the death rate in the population is ______ individuals per Drosophila per week.

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2022-CR6-170प्राणीशास्त्र (Zoology)
In which of the following animals, digestive tract has additional chambers like crop and gizzard?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2022-CR6-171प्राणीशास्त्र (Zoology)
Given below are two statements: Statement I : The release of sperms into the seminiferous tubules is called spermiation. Statement II : Spermiogenesis is the process of formation of sperms from spermatogonia. In the light of the above statements, choose the most appropriate answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2022-CR6-172प्राणीशास्त्र (Zoology)
Which of the following functions is not performed by secretions from salivary glands?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2022-CR6-173प्राणीशास्त्र (Zoology)
In-situ conservation refers to

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2022-CR6-174प्राणीशास्त्र (Zoology)
In gene therapy of Adenosine Deaminase (ADA) deficiency, the patient requires periodic infusion of genetically engineered lymphocytes because

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2022-CR6-175प्राणीशास्त्र (Zoology)
Given below are two statements : Statement I : Mycoplasma can pass through less than 1 micron filter size. Statement II : Mycoplasma are bacteria with cell wall. In the light of the above statements, choose the most appropriate answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2022-CR6-176प्राणीशास्त्र (Zoology)
Which of the following is not the function of conducting part of respiratory system?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2022-CR6-177प्राणीशास्त्र (Zoology)
In the taxonomic categories which hierarchical arrangement in ascending order is correct in case of animals?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2022-CR6-178प्राणीशास्त्र (Zoology)
Given below are two statements : Statement I : Fatty acids and glycerols cannot be absorbed into the blood. Statement II : Specialized lymphatic capillaries called lacteals carry chylomicrons into lymphatic vessels and ultimately into the blood. In the light of the above statements, choose the most appropriate answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2022-CR6-179प्राणीशास्त्र (Zoology)
Given below are two statements: Statement I: Autoimmune disorder is a condition where body defense mechanism recognizes its own cells as foreign bodies. Statement II: Rheumatoid arthritis is a condition where body does not attack self cells. In the light of the above statements, choose the most appropriate answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2022-CR6-180प्राणीशास्त्र (Zoology)
In an E. Coli strain i gene gets mutated and its product can not bind the inducer molecule. If growth medium is provided with lactose, what will be the outcome?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2022-CR6-181प्राणीशास्त्र (Zoology)
Select the incorrect statement with reference to mitosis

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2022-CR6-182प्राणीशास्त्र (Zoology)
Which of the following is a correct match for disease and its symptoms?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2022-CR6-183प्राणीशास्त्र (Zoology)
Natural selection where more individuals acquire specific character value other than the mean character value, leads to

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2022-CR6-184प्राणीशास्त्र (Zoology)
Under normal physiological conditions in human being every 100 ml of oxygenated blood can deliver ________ ml of O2 to the tissues.

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2022-CR6-185प्राणीशास्त्र (Zoology)
If the length of a DNA molecule is 1.1 metres, what will be the approximate number of base pairs?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2022-CR6-186प्राणीशास्त्र (Zoology)विभाग B
Select the incorrect statement with respect to acquired immunity.

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2022-CR6-187प्राणीशास्त्र (Zoology)विभाग B
Match List-I with List-II
List IList II
ABronchiolesIDense Regular Connective Tissue
BGoblet CellIILoose Connective Tissue
CTendonsIIIGlandular Tissue
DAdipose TissueIVCiliated Epithelium

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2022-CR6-188प्राणीशास्त्र (Zoology)विभाग B
The recombination frequency between the genes a & c is 5%, b & c is 15%, b & d is 9%, a & b is 20%, c & d is 24% and a & d is 29%. What will be the sequence of these genes on a linear chromosome?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2022-CR6-189प्राणीशास्त्र (Zoology)विभाग B
Which one of the following statements is correct?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2022-CR6-190प्राणीशास्त्र (Zoology)विभाग B
Statements related to human Insulin are given below. Which statement(s) is/are correct about genetically engineered Insulin? (a) Pro-hormone insulin contain extra stretch of C-peptide (b) A-peptide and B-peptide chains of insulin were produced separately in E.coli, extracted and combined by creating disulphide bond between them. (c) Insulin used for treating Diabetes was extracted from Cattles and Pigs. (d) Pro-hormone Insulin needs to be processed for converting into a mature and functional hormone. (e) Some patients develop allergic reactions to the foreign insulin. Choose the most appropriate answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2022-CR6-191प्राणीशास्त्र (Zoology)विभाग B
If a colour blind female marries a man whose mother was also colour blind, what are the chances of her progeny having colour blindness?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2022-CR6-192प्राणीशास्त्र (Zoology)विभाग B
Which of the following are not the effects of Parathyroid hormone?: (a) Stimulates the process of bone resorption (b) Decreases Ca2+ level in blood (c) Reabsorption of Ca2+ by renal tubules (d) Decreases the absorption of Ca2+ from digested food (e) Increases metabolism of carbohydrates Choose the most appropriate answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2022-CR6-193प्राणीशास्त्र (Zoology)विभाग B
Ten E.coli cells with 15N - dsDNA are incubated in medium containing 14N nucleotide. After 60 minutes, how many E.coli cells will have DNA totally free from 15N?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2022-CR6-194प्राणीशास्त्र (Zoology)विभाग B
Select the incorrect statement regarding synapses

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2022-CR6-195प्राणीशास्त्र (Zoology)विभाग B
Given below are two statements: Statement I : In a scrubber the exhaust from the thermal plant is passed through the electric wires to charge the dust particles. Statement II : Particulate matter (PM 2.5) cannot be removed by scrubber but can be removed by an electrostatic precipitator. In the light of the above statements, choose the most appropriate answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2022-CR6-196प्राणीशास्त्र (Zoology)विभाग B
Which of the following is not a desirable feature of a cloning vector?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2022-CR6-197प्राणीशास्त्र (Zoology)विभाग B
Which of the following statements is not true?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2022-CR6-198प्राणीशास्त्र (Zoology)विभाग B
Match List-I with List-II with respect to methods of Contraception and their respective actions: List-I — (a) Diaphragms, (b) Contraceptive Pills, (c) Intra Uterine Devices, (d) Lactational Amenorrhea. List II — I. Inhibit ovulation and Implantation, II. Increase phagocytosis of sperm within Uterus, III. Absence of Menstrual cycle and ovulation following parturition, IV. They cover the cervix blocking the entry of sperms. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2022-CR6-199प्राणीशास्त्र (Zoology)विभाग B
Match List-I with List-II
List IList II
AGlycogenIHormone
BGlobulinIIBiocatalyst
CSteroidsIIIAntibody
DThrombinIVStorage product

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2022-CR6-200प्राणीशास्त्र (Zoology)विभाग B
Which of the following is a correct statement?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2023-CG3-101प्राणीशास्त्र (Zoology)
What is the role of RNA polymerase III in the process of transcription in Eukaryotes?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2023-CG3-102प्राणीशास्त्र (Zoology)
Movement and accumulation of ions across a membrane against their concentration gradient can be explained by

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2023-CG3-104प्राणीशास्त्र (Zoology)
The thickness of ozone in a column of air in the atmosphere is measured in terms of

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2023-CG3-110प्राणीशास्त्र (Zoology)
Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R: Assertion A: ATP is used at two steps in glycolysis. Reason R: First ATP is used in converting glucose into glucose-6-phosphate and second ATP is used in conversion of fructose-6-phosphate into fructose-1,6-diphosphate. In the light of the above statements, choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2023-CG3-113प्राणीशास्त्र (Zoology)
Which of the following stages of meiosis involves division of centromere?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2023-CG3-115प्राणीशास्त्र (Zoology)
Expressed Sequence Tags (ESTs) refers to

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2023-CG3-118प्राणीशास्त्र (Zoology)
The process of appearance of recombination nodules occurs at which sub stage of prophase I in meiosis?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2023-CG3-119प्राणीशास्त्र (Zoology)
The phenomenon of pleiotropism refers to

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2023-CG3-120प्राणीशास्त्र (Zoology)
Identify the correct statements: A. Detrivores perform fragmentation. B. The humus is further degraded by some microbes during mineralization. C. Water soluble inorganic nutrients go down into the soil and get precipitated by a process called leaching. D. The detritus food chain begins with living organisms. E. Earthworms break down detritus into smaller particles by a process called catabolism. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2023-CG3-124प्राणीशास्त्र (Zoology)
In gene gun method used to introduce alien DNA into host cells, microparticles of ________ metal are used.

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2023-CG3-125प्राणीशास्त्र (Zoology)
Among 'The Evil Quartet', which one is considered the most important cause driving extinction of species?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2023-CG3-127प्राणीशास्त्र (Zoology)
Unequivocal proof that DNA is the genetic material was first proposed by

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2023-CG3-133प्राणीशास्त्र (Zoology)
During the purification process for recombinant DNA technology, addition of chilled ethanol precipitates out

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2023-CG3-137प्राणीशास्त्र (Zoology)विभाग B
How many different proteins does the ribosome consist of?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2023-CG3-138प्राणीशास्त्र (Zoology)विभाग B
Melonate inhibits the growth of pathogenic bacteria by inhibiting the activity of

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2023-CG3-140प्राणीशास्त्र (Zoology)विभाग B
Given below are two statements: Statement I: Gause's 'Competitive Exclusion Principle' states that two closely related species competing for the same resources cannot co-exist indefinitely and competitively inferior one will be eliminated eventually. Statement II: In general, carnivores are more adversely affected by competition than herbivores. In the light of the above statements, choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2023-CG3-143प्राणीशास्त्र (Zoology)विभाग B
Which one of the following statements is NOT correct?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2023-CG3-144प्राणीशास्त्र (Zoology)विभाग B
Which of the following statements are correct about Klinefelter's Syndrome? A. This disorder was first described by Langdon Down (1866). B. Such an individual has overall masculine development. However, the feminine developement is also expressed. C. The affected individual is short statured. D. Physical, psychomotor and mental development is retarded. E. Such individuals are sterile. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2023-CG3-146प्राणीशास्त्र (Zoology)विभाग B
Match List I with List II
List IList II
AM PhaseIProteins are synthesized
BG2 PhaseIIInactive phase
CQuiescent stageIIIInterval between mitosis and initiation of DNA replication
DG1 PhaseIVEquational division

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2023-CG3-149प्राणीशास्त्र (Zoology)विभाग B
Main steps in the formation of Recombinant DNA are given below. Arrange these steps in a correct sequence. A. Insertion of recombinant DNA into the host cell B. Cutting of DNA at specific location by restriction enzyme C. Isolation of desired DNA fragment D. Amplification of gene of interest using PCR. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2023-CG3-151प्राणीशास्त्र (Zoology)
Match List I with List II
List I (Cells)List II (Secretion)
APeptic cellsIMucus
BGoblet cellsIIBile juice
COxyntic cellsIIIProenzyme pepsinogen
DHepatic cellsIVHCl and intrinsic factor for absorption of vitamin B12

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2023-CG3-152प्राणीशास्त्र (Zoology)
Which one of the following common sexually transmitted diseases is completely curable when detected early and treated properly?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2023-CG3-153प्राणीशास्त्र (Zoology)
Select the correct group/set of Australian Marsupials exhibiting adaptive radiation.

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2023-CG3-154प्राणीशास्त्र (Zoology)
Match List I with List II
List IList II
AP-waveIBeginning of systole
BQ-waveIIRepolarisation of ventricles
CQRS complexIIIDepolarisation of atria
DT-waveIVDepolarisation of ventricles

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2023-CG3-155प्राणीशास्त्र (Zoology)
Match List I with List II
List IList II
ARingwormIHaemophilus influenzae
BFilariasisIITrichophyton
CMalariaIIIWuchereria bancrofti
DPneumoniaIVPlasmodium vivax

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2023-CG3-156प्राणीशास्त्र (Zoology)
Given below are two statements: Statement I: Vas deferens receives a duct from seminal vesicle and opens into urethra as the ejaculatory duct. Statement II: The cavity of the cervix is called cervical canal which along with vagina forms birth canal. In the light of the above statements, choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2023-CG3-158प्राणीशास्त्र (Zoology)
Radial symmetry is NOT found in adults of phylum ________.

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2023-CG3-159प्राणीशास्त्र (Zoology)
Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R. Assertion A: Nephrons are of two types: Cortical & Juxta medullary, based on their relative position in cortex and medulla. Reason R: Juxta medullary nephrons have short loop of Henle whereas, cortical nephrons have longer loop of Henle. In the light of the above statements, choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2023-CG3-160प्राणीशास्त्र (Zoology)
Vital capacity of lung is __________.

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2023-CG3-162प्राणीशास्त्र (Zoology)
Match List I with List II
List IList II
AGene 'a'Iβ-galactosidase
BGene 'y'IITransacetylase
CGene 'i'IIIPermease
DGene 'z'IVRepressor protein

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2023-CG3-163प्राणीशास्त्र (Zoology)
Match List I with List II
List IList II
AHeroinIEffect on cardiovascular system
BMarijuanaIISlow down body function
CCocaineIIIPainkiller
DMorphineIVInterfere with transport of dopamine

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2023-CG3-164प्राणीशास्त्र (Zoology)
Match List I with List II
List I (Type of Joint)List II (Found between)
ACartilaginous JointIBetween flat skull bones
BBall and Socket JointIIBetween adjacent vertebrae in vertebral column
CFibrous JointIIIBetween carpal and metacarpal of thumb
DSaddle JointIVBetween Humerus and Pectoral girdle

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2023-CG3-165प्राणीशास्त्र (Zoology)
Match List I with List II
List IList II
ACCKIKidney
BGIPIIHeart
CANFIIIGastric gland
DADHIVPancreas

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2023-CG3-168प्राणीशास्त्र (Zoology)
In which blood corpuscles, the HIV undergoes replication and produces progeny viruses?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2023-CG3-169प्राणीशास्त्र (Zoology)
Match List I with List II with respect to human eye
List IList II
AFoveaIVisible coloured portion of eye that regulates diameter of pupil.
BIrisIIExternal layer of eye formed of dense connective tissue.
CBlind spotIIIPoint of greatest visual acuity or resolution.
DScleraIVPoint where optic nerve leaves the eyeball and photoreceptor cells are absent

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2023-CG3-171प्राणीशास्त्र (Zoology)
Given below are two statements: Statement I: Ligaments are dense irregular tissue. Statement II: Cartilage is dense regular tissue. In the light of the above statements, choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2023-CG3-172प्राणीशास्त्र (Zoology)
Which one of the following symbols represents mating between relatives in human pedigree analysis? (figure-dependent: pedigree chart symbols — symbol A: three unrelated shaded shapes square circle diamond; symbol B: unshaded square linked by a single horizontal line to unshaded circle; symbol C: unshaded square linked by a DOUBLE horizontal line to unshaded circle, the consanguineous mating symbol; symbol D: a mating pair connected to a shaded affected offspring square below — not transcribable as text)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2023-CG3-174प्राणीशास्त्र (Zoology)
Match List I with List II
List IList II
ATaeniaINephridia
BParamoeciumIIContractile vacuole
CPeriplanetaIIIFlame cells
DPheretimaIVUrecose gland

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2023-CG3-175प्राणीशास्त्र (Zoology)
Given below are two statements: one is labelled as Assertion A and other is labelled as Reason R. Assertion A: Amniocentesis for sex determination is one of the strategies of Reproductive and Child Health Care Programme. Reason R: Ban on amniocentesis checks increasing menace of female foeticide. In the light of the above statements, choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2023-CG3-177प्राणीशास्त्र (Zoology)
Once the undigested and unabsorbed substances enter the caecum, their backflow is prevented by

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2023-CG3-178प्राणीशास्त्र (Zoology)
Match List I with List II
List IList II
AVasectomyIOral method
BCoitus interruptusIIBarrier method
CCervical capsIIISurgical method
DSaheliIVNatural method

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2023-CG3-180प्राणीशास्त्र (Zoology)
Which of the following is not a cloning vector?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2023-CG3-181प्राणीशास्त्र (Zoology)
Which of the following functions is carried out by cytoskeleton in a cell?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2023-CG3-182प्राणीशास्त्र (Zoology)
Given below are two statements: Statement I: A protein is imagined as a line, the left end represented by first amino acid (C-terminal) and the right end represented by last amino acid (N-terminal). Statement II: Adult human haemoglobin, consists of 4 subunits (two subunits of α type and two subunits of β type.) In the light of the above statements, choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2023-CG3-183प्राणीशास्त्र (Zoology)
Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R. Assertion A: Endometrium is necessary for implantation of blastocyst. Reason R: In the absence of fertilization, the corpus luteum degenerates that causes disintegration of endometrium. In the light of the above statements, choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2023-CG3-184प्राणीशास्त्र (Zoology)
Broad palm with single palm crease is visible in a person suffering from

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2023-CG3-185प्राणीशास्त्र (Zoology)
Which of the following statements are correct regarding female reproductive cycle? A. In non-primate mammals cyclical changes during reproduction are called oestrus cycle. B. First menstrual cycle begins at puberty and is called menopause. C. Lack of menstruation may be indicative of pregnancy. D. Cyclic menstruation extends between menarche and menopause. Choose the most appropriate answer from the options given below.

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2023-CG3-186प्राणीशास्त्र (Zoology)विभाग B
Which of the following statements are correct regarding skeletal muscle? A. Muscle bundles are held together by collagenous connective tissue layer called fascicle. B. Sarcoplasmic reticulum of muscle fibre is a store house of calcium ions. C. Striated appearance of skeletal muscle fibre is due to distribution pattern of actin and myosin proteins. D. M line is considered as functional unit of contraction called sarcomere. Choose the most appropriate answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2023-CG3-187प्राणीशास्त्र (Zoology)विभाग B
Which of the following is characteristic feature of cockroach regarding sexual dimorphism?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2023-CG3-188प्राणीशास्त्र (Zoology)विभाग B
Which of the following statements are correct? A. An excessive loss of body fluid from the body switches off osmoreceptors. B. ADH facilitates water reabsorption to prevent diuresis. C. ANF causes vasodilation. D. ADH causes increase in blood pressure. E. ADH is responsible for decrease in GFR. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2023-CG3-190प्राणीशास्त्र (Zoology)विभाग B
The unique mammalian characteristics are

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2023-CG3-192प्राणीशास्त्र (Zoology)विभाग B
Given below are two statements: Statement I: During G0 phase of cell cycle, the cell is metabolically inactive. Statement II: The centrosome undergoes duplication during S phase of interphase. In the light of the above statements, choose the most appropriate answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2023-CG3-193प्राणीशास्त्र (Zoology)विभाग B
Select the correct statements with reference to chordates. A. Presence of a mid-dorsal, solid and double nerve cord. B. Presence of closed circulatory system. C. Presence of paired pharyngeal gill slits. D. Presence of dorsal heart E. Triploblastic pseudocoelomate animals. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2023-CG3-194प्राणीशास्त्र (Zoology)विभाग B
Match List I with List II
List IList II
AMast cellsICiliated epithelium
BInner surface of bronchioleIIAreolar connective tissue
CBloodIIICuboidal epithelium
DTubular parts of nephronIVSpecialised connective tissue

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2023-CG3-196प्राणीशास्त्र (Zoology)विभाग B
Which of the following statements are correct? A. Basophils are most abundant cells of the total WBCs B. Basophils secrete histamine, serotonin and heparin C. Basophils are involved in inflammatory response D. Basophils have kidney shaped nucleus E. Basophils are agranulocytes. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2023-CG3-197प्राणीशास्त्र (Zoology)विभाग B
Which of the following are NOT under the control of thyroid hormone? A. Maintenance of water and electrolyte balance B. Regulation of basal metabolic rate C. Normal rhythm of sleep-wake cycle D. Development of immune system E. Support the process of RBCs formation. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2023-CG3-198प्राणीशास्त्र (Zoology)विभाग B
Select the correct statements. A. Tetrad formation is seen during Leptotene. B. During Anaphase, the centromeres split and chromatids separate. C. Terminalization takes place during Pachytene. D. Nucleolus, Golgi complex and ER are reformed during Telophase. E. Crossing over takes place between sister chromatids of homologous chromosome. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2023-CG3-199प्राणीशास्त्र (Zoology)विभाग B
The parts of human brain that helps in regulation of sexual behaviour, expression of excitement, pleasure, rage, fear etc. are

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2023-CG3-200प्राणीशास्त्र (Zoology)विभाग B
In cockroach, excretion is brought about by- A. Phallic gland B. Urecose gland C. Nephrocytes D. Fat body E. Collaterial glands. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2024-CT3-151प्राणीशास्त्र (Zoology)
Match List I with List II
List IList II
ATyphoidIFungus
BLeishmaniasisIINematode
CRingwormIIIProtozoa
DFilariasisIVBacteria

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2024-CT3-152प्राणीशास्त्र (Zoology)
Match List I with List II
List IList II
ANon-medicated IUDIMultiload 375
BCopper releasing IUDIIProgestonges
CHormone releasing IUDIIILippes loop
DImplantsIVLNG-20

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2024-CT3-153प्राणीशास्त्र (Zoology)
Given below are two statements: Statement I: The presence or absence of hymen is not a reliable indicator of virginity. Statement II: The hymen is torn during the first coitus only. In the light of the above statements, choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2024-CT3-154प्राणीशास्त्र (Zoology)
In both sexes of cockroach, a pair of jointed filamentous structures called anal cerci are present on

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2024-CT3-155प्राणीशास्त्र (Zoology)
Match List I with List II
List IList II
APonsIProvides additional space for Neurons, regulates posture and balance.
BHypothalamusIIControls respiration and gastric secretions.
CMedullaIIIConnects different regions of the brain.
DCerebellumIVNeuro secretory cells

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2024-CT3-156प्राणीशास्त्र (Zoology)
Which of the following is not a steroid hormone?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2024-CT3-157प्राणीशास्त्र (Zoology)
Which one is the correct product of DNA dependent RNA polymerase to the given template? 3' TACATGGCAAATATCCATTCA5'

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2024-CT3-158प्राणीशास्त्र (Zoology)
Three type of muscles are given as a, b and c. Identify the correct matching pair along with their location in human body.

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2024-CT3-159प्राणीशास्त्र (Zoology)
Following are the stages of cell division: A. Gap 2 phase B. Cytokinesis C. Synthesis phase D. Karyokinesis E. Gap 1 phase Choose the correct sequence of stages from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2024-CT3-160प्राणीशास्त्र (Zoology)
Which of the following are Autoimmune disorders? A. Myasthenia gravis B. Rheumatoid arthritis C. Gout D. Muscular dystrophy E. Systemic Lupus Erythematosus (SLE) Choose the most appropriate answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2024-CT3-161प्राणीशास्त्र (Zoology)
Match List I with List II
List IList II
ALipaseIPeptide bond
BNucleaseIIEster bond
CProteaseIIIGlycosidic bond
DAmylaseIVPhosphodiester bond

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2024-CT3-162प्राणीशास्त्र (Zoology)
The flippers of the Penguins and Dolphins are the example of the

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2024-CT3-163प्राणीशास्त्र (Zoology)
Match List I with List II
List IList II
AExpiratory capacityIExpiratory reserve volume + Tidal volume
BFunctional residual capacityIITidal volume + Expiratory reserve volume
CVital capacityIIITidal volume + Inspiratory reserve volume
DInspiratory capacityIVExpiratory reserve volume + Residual volume

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2024-CT3-164प्राणीशास्त्र (Zoology)
Which one of the following factors will not affect the Hardy-Weinberg equilibrium?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2024-CT3-165प्राणीशास्त्र (Zoology)
Given below are some stages of human evolution. Arrange them in correct sequence. (Past to Recent) A. Homo habilis B. Homo sapiens C. Homo neanderthalensis D. Homo erectus Choose the correct sequence of human evolution from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2024-CT3-166प्राणीशास्त्र (Zoology)
Following are the stages of pathway for conduction of an action potential through the heart: A. AV bundle B. Purkinje fibres C. AV node D. Bundle branches E. SA node Choose the correct sequence of pathway from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2024-CT3-167प्राणीशास्त्र (Zoology)
Which of the following factors are favourable for the formation of oxyhaemoglobin in alveoli?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2024-CT3-168प्राणीशास्त्र (Zoology)
Match List I with List II
List IList II
Aα-1 antitrypsinICotton bollworm
BCry IAbIIADA deficiency
CCry IAcIIIEmphysema
DEnzyme replacement therapyIVCorn borer

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2024-CT3-169प्राणीशास्त्र (Zoology)
Given below are two statement: one is labelled as Assertion A and the other is labelled as Reason R: Assertion A: FSH acts upon ovarian follicles in female and Leydig cells in male. Reason R: Growing ovarian follicles secrete estrogen in female while interstitial cells secrete androgen in male human being. In the light of the above statements, choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2024-CT3-171प्राणीशास्त्र (Zoology)
Match List I with List II
List IList II
ACocaineIEffective sedative in surgery
BHeroinIICannabis sativa
CMorphineIIIErythroxylum
DMarijuanaIVPapaver somniferum

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2024-CT3-172प्राणीशास्त्र (Zoology)
Consider the following statements: A. Annelids are true coelomates B. Poriferans are pseudocoelomates C. Aschelminthes are acoelomates D. Platyhelminthes are pseudocoelomates Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2024-CT3-173प्राणीशास्त्र (Zoology)
Given below are two statements: Statements I: In the nephron the descending limb of loop of Henle is impermeable to water and permeable to electrolytes. Statement II: The proximal convoluted tubule is lined by simple columnar brush border epithelium and increases the surface area for reabsorption. In the light of the above statements, choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2024-CT3-174प्राणीशास्त्र (Zoology)
Match List I with List II
List IList II
AFibrous jointsIAdjacent vertebrae, limited movement
BCartilaginous jointsIIHumerus and pectoral girdle, rotational movement
CHinge jointIIISkull, don't allow any movement
DBall and socket jointIVKnee, help in locomotion

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2024-CT3-175प्राणीशास्त्र (Zoology)
Which of the following is not a natural/traditional contraceptive method?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2024-CT3-176प्राणीशास्त्र (Zoology)
Match List I with List II: List I — A. Pleurobrachia, B. Radula, C. Stomochord, D. Air bladder. List II — I. Mollusca, II. Ctenophora, III. Osteichthyes, IV. Hemichordata. Choose the correct answer form the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2024-CT3-177प्राणीशास्त्र (Zoology)
Match List I with List II: List I — A. Axoneme, B. Cartwheel, C. Crista, D. Satellite. List II — I. Centriole, II. Cilia and flagella, III. Chromosome, IV. Mitochondria. Choose the correct answer form the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2024-CT3-178प्राणीशास्त्र (Zoology)
Which of the following statements is incorrect?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2024-CT3-179प्राणीशास्त्र (Zoology)
Match List I with List II: List I — A. Diakinesis, B. Pachytene, C. Zygotene, D. Leptotene. List II — I. Synaptonemal complex formation, II. Completion of terminalisation of chiasmata, III. Chromosomes look like thin threads, IV. Appearance of recombination nodules. Choose the correct answer form the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2024-CT3-180प्राणीशास्त्र (Zoology)
Match List I with List II: List I — A. Common cold, B. Haemozoin, C. Widal test, D. Allergy. List II — I. Plasmodium, II. Typhoid, III. Rhinoviruses, IV. Dust mites. Choose the correct answer form the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2024-CT3-181प्राणीशास्त्र (Zoology)
Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R: Assertion A : Breast-feeding during initial period of infant growth is recommended by doctors for bringing a healthy baby. Reason R: Colostrum contains several antibodies absolutely essential to develop resistance for the born baby. In the light of the above statements, choose the most appropriate answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2024-CT3-182प्राणीशास्त्र (Zoology)
Match List I with List II: List I — A. Pterophyllum, B. Myxine, C. Pristis, D. Exocoetus. List II — I. Hag fish, II. Saw fish, III. Angel fish, IV. Flying fish. Choose the correct answer form the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2024-CT3-183प्राणीशास्त्र (Zoology)
The "Ti plasmid" of Agrobacterium tumefaciens stands for

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2024-CT3-184प्राणीशास्त्र (Zoology)
Which of the following is not a component of Fallopian tube?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2024-CT3-185प्राणीशास्त्र (Zoology)
Match List I with List II: List I — A. Down's syndrome, B. α - Thalassemia, C. β-Thalassemia, D. Klinefelter's syndrome. List II — I. 11th chromosome, II. 'X' chromosome, III. 21st chromosome, IV. 16th chromosome. Choose the correct answer form the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2024-CT3-186प्राणीशास्त्र (Zoology)विभाग B
The following are the statements about non-chordates: A. Pharynx is perforated by gill slits. B. Notochord is absent. C. Central nervous system is dorsal. D. Heart is dorsal if present. E. Post anal tail is absent. Choose the most appropriate answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2024-CT3-187प्राणीशास्त्र (Zoology)विभाग B
Match List I with List II: List I — A. Mesozoic Era, B. Proterozoic Era, C. Cenozoic Era, D. Paleozoic Era. List II — I. Lower invertebrates, II. Fish & Amphibia, III. Birds & Reptiles, IV. Mammals. Choose the correct answer form the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2024-CT3-188प्राणीशास्त्र (Zoology)विभाग B
Given below are two statements: Statement I: The cerebral hemispheres are connected by nerve tract known as corpus callosum. Statement II: The brain stem consists of the medulla oblongata, pons and cerebrum. In the light of the above statements, choose the most appropriate answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2024-CT3-189प्राणीशास्त्र (Zoology)विभाग B
Identify the correct option (A), (B), (C), (D) with respect to spermatogenesis. GnRH → LH → (A); ↓ ↓ (B) → (C); ↓ ↓ Androgens → Factors → ↓ ↓ Formation of spermatids → (D)

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2024-CT3-190प्राणीशास्त्र (Zoology)विभाग B
Match List I with List II
List IList II
ARNA polymerase IIIIsnRNPs
BTermination of transcriptionIIPromotor
CSplicing of ExonsIIIRho factor
DTata boxIVSnRNAs, tRNA

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2024-CT3-191प्राणीशास्त्र (Zoology)विभाग B
Match List I with List II
List IList II
AExophthalmic goiterIExcess secretion of cortisol, moon face & hyperglycemia
BAcromegalyIIHypo-secretion of thyroid hormone and stunted growth.
CCushing's syndromeIIIHyper secretion of thyroid hormone & protruding eye balls.
DCretinismIVExcessive secretion of growth hormone

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2024-CT3-192प्राणीशास्त्र (Zoology)विभाग B
Match List I with List II
List IList II
AUnicellular glandular epitheliumISalivary glands
BCompound epitheliumIIPancreas
CMulticellular glandular epitheliumIIIGoblet cells of alimentary canal
DEndocrine glandular epitheliumIVMoist surface of buccal cavity

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2024-CT3-193प्राणीशास्त्र (Zoology)विभाग B
Given below are two statements: Statement I: Bone marrow is the main lymphoid organ where all blood cells including lymphocytes are produced. Statement II: Both bone marrow and thymus provide micro environments for the development and maturation of T-lymphocytes. In the light of the above statements, choose the most appropriate answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2024-CT3-194प्राणीशास्त्र (Zoology)विभाग B
Match List I with List II
List IList II
AThe structures used for storing of food.IGizzard
BRing of 6-8 blind tubulesIIGastric Caeca
CRing of 100-150 yellow coloured thin filaments at junction of midgut and hindgut.IIIMalpighian tubules
DThe structures used for grinding the food.IVCrop

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2024-CT3-195प्राणीशास्त्र (Zoology)विभाग B
Choose the correct statement given below regarding juxtamedullary nephron

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2024-CT3-196प्राणीशास्त्र (Zoology)विभाग B
Match List I with List II
List IList II
AP waveIHeart muscles are electrically silent.
BQRS complexIIDepolarisation of ventricles.
CT waveIIIDepolarisation of atria.
DT-P gapIVRepolarisation of ventricles

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2024-CT3-197प्राणीशास्त्र (Zoology)विभाग B
As per ABO blood grouping system, the blood group of fathers is B+, mother is A+ and child is O+. Their respective genotype can be A. IBi/IAi/ii B. IBIB/IAIA/ii C. IAIB/iIA/IBi D. IAi/IBi/IAi E. iIB/iIA/IAIB Choose the most appropriate answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2024-CT3-198प्राणीशास्त्र (Zoology)विभाग B
Given below are two statements: Statement I: Gause's competitive exclusive principle states that two closely related species competing for different resources cannot exist indefinitely. Statement II: According to Gause's principle, during competition, the inferior will be eliminated. This may be true if resources are limiting. In the light of the above statements, choose the most appropriate answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2024-CT3-199प्राणीशास्त्र (Zoology)विभाग B
Regarding catalytic cycle of an enzyme action, selecte the correct sequential steps: A. Substrate enzyme complex formation. B. Free enzyme ready to bind with another substrate. C. Release fo products. D. Chemical bonds of the substrate broken. E. Substrate bindig to active site. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2024-CT3-200प्राणीशास्त्र (Zoology)विभाग B
Given below are two statements: Statement I: Mitochondria and chloroplasts are both double membrane bound organelles. Statement II: Inner membrane of mitochondria is relatively less permeable, as compared to chloroplast. In the light of the above statements, choose the most appropriate answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2025-C45-093प्राणीशास्त्र (Zoology)
What are the potential drawbacks in adoption of the IVF method? A. High fatality risk to mother B. Expensive instruments and reagents C. Husband/wife necessary for being donors D. Less adoption of orphans E. Not available in India F. Possibility that the early embryo does not survive. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2025-C45-094प्राणीशास्त्र (Zoology)
What is the name of the blood vessel that carries deoxygenated blood from the body to the heart in a frog?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2025-C45-098प्राणीशास्त्र (Zoology)
From the statements given below choose the correct option: A. The eukaryotic ribosomes are 80S and prokaryotic ribosomes are 70S. B. Each ribosome has two sub-units. C. The two sub-units of 80S ribosome are 60S and 40S while that of 70S are 50S and 30S. D. The two sub-units of 80S ribosome are 60S and 20S and that of 70S are 50S and 20S. E. The two sub-units of 80S are 60S and 30S and that of 70S are 50S and 30S.

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2025-C45-101प्राणीशास्त्र (Zoology)
Match List-I with List-II
List IList II
AEmphysemaIRapid spasms in muscle due to low Ca++ in body fluid
BAngina PectorisIIDamaged alveolar walls and decreased respiratory surface
CGlomerulonephritisIIIAcute chest pain when not enough oxygen is reaching to heart muscle
DTetanyIVInflammation of glomeruli of kidney

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2025-C45-103प्राणीशास्त्र (Zoology)
Which of the following is an example of non-distilled alcoholic beverage produced by yeast?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2025-C45-105प्राणीशास्त्र (Zoology)
Streptokinase produced by bacterium Streptococcus is used for

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2025-C45-106प्राणीशास्त्र (Zoology)
Which chromosome in the human genome has the highest number of genes?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2025-C45-107प्राणीशास्त्र (Zoology)
Which of the following statement is correct about location of the male frog copulatory pad?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2025-C45-109प्राणीशास्त्र (Zoology)
While trying to find out the characteristic of a newly found animal, a researcher did the histology of adult animal and observed a cavity with presence of mesodermal tissue towards the body wall but no mesodermal tissue was observed towards the alimentary canal. What could be the possible coelome of that animal?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2025-C45-110प्राणीशास्त्र (Zoology)
Match List-I with List-II
List IList II
AHeadIEnzymes
BMiddle pieceIISperm motility
CAcrosomeIIIEnergy
DTailIVGenetic material

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2025-C45-112प्राणीशास्त्र (Zoology)
Cardiac activities of the heart are regulated by: A. Nodal tissue B. A special neural centre in the medulla oblongata C. Adrenal medullary hormones D. Adrenal cortical hormones. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2025-C45-114प्राणीशास्त्र (Zoology)
Given below are two statements: Statement I: Transfer RNAs and ribosomal RNA do not interact with mRNA. Statement II: RNA interference (RNAi) takes place in all eukaryotic organisms as a method of cellular defence. In the light of the above statements, choose the most appropriate answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2025-C45-117प्राणीशास्त्र (Zoology)
Name the class of enzyme that usually catalyze the following reaction: S − G + S# → S + S# − G Where, G → a group other than hydrogen, S → a substrate, S# → another substrate

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2025-C45-120प्राणीशास्त्र (Zoology)
Which are correct: A. Computed tomography and magnetic resonance imaging detect cancers of internal organs. B. Chemotherapeutics drugs are used to kill non-cancerous cells. C. α-interferon activate the cancer patients' immune system and helps in destroying the tumour. D. Chemotherapeutic drugs are biological response modifiers. E. In the case of leukaemia blood cells counts are decreased. Choose the correct answer from the option given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2025-C45-123प्राणीशास्त्र (Zoology)
Find the correct statements: A. In human pregnancy, the major organ systems are formed at the end of 12 weeks. B. In human pregnancy the major organ systems are formed at the end of 8 weeks. C. In human pregnancy heart is formed after one month of gestation. D. In human pregnancy, limbs and digits develop by the end of second month. E. In human pregnancy the appearance of hair usually observed in the fifth month. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2025-C45-128प्राणीशास्त्र (Zoology)
A specialized membranous structure in a prokaryotic cell which helps in cell wall formation, DNA replication and respiration is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2025-C45-130प्राणीशास्त्र (Zoology)
What is the pattern of inheritance for polygenic trait?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2025-C45-132प्राणीशास्त्र (Zoology)
Each of the following characteristics represent a Kingdom proposed by Whittaker. Arrange the following in increasing order of complexity of body organization. A. Multicellular heterotrophs with cell wall made of chitin. B. Heterotrophs with tissue/organ/organ system level of body organization. C. Prokaryotes with cell wall made of polysaccharides and amino acids. D. Eukaryotic autotrophs with tissue/organ level of body organization. E. Eukaryotes with cellular body organization. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2025-C45-134प्राणीशास्त्र (Zoology)
Match List-I with List-II
List IList II
AAlfred Hershey and Martha ChaseIStreptococcus Pneumoniae
BEuchromatinIIDensely packed and dark-stained
CFrederick GriffithIIILoosely packed and light-stained
DHeterochromatinIVDNA as genetic material confirmation

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2025-C45-135प्राणीशास्त्र (Zoology)
Neoplastic characteristics of cells refers to: A. A mass of proliferating cell B. Rapid growth of cells C. Invasion and damage to the surrounding tissue D. Those confined to original location. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2025-C45-136प्राणीशास्त्र (Zoology)
Given below are two statements: Statement I: The DNA fragments extracted from gel electrophoresis can be used in construction of recombinant DNA. Statement II: Smaller size DNA fragments are observed near anode while larger fragments are found near the wells in an agarose gel. In the light of the above statements, choose the most appropriate answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2025-C45-137प्राणीशास्त्र (Zoology)
Match List I with List II
List IList II
AAdenosineINitrogen base
BAdenylic acidIINucleotide
CAdenineIIINucleoside
DAlanineIVAmino acid

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2025-C45-138प्राणीशास्त्र (Zoology)
Consider the following: A. The reductive division for the human female gametogenesis starts earlier than that of the male gametogenesis. B. The gap between the first meiotic division and the second meiotic division is much shorter for males compared to females. C. The first polar body is associated with the formation of the primary oocyte. D. Luteinizing Hormone (LH) surge leads to disintegration of the endometrium and onset of menstrual bleeding. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2025-C45-139प्राणीशास्त्र (Zoology)
All living members of the class Cyclostomata are

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2025-C45-142प्राणीशास्त्र (Zoology)
Given below are two statements: one is labelled as Assertion (A) and the other is labelled as Reason (R). Assertion (A): All vertebrates are chordates but all chordates are not vertebrate. Reason (R): The members of subphylum vertebrata possess notochord, during the embryonic period, the notochord is replaced by a cartilaginous or bony vertebral column in adults. In the light of the above statements, choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2025-C45-143प्राणीशास्त्र (Zoology)
Identify the statement that is NOT correct.

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2025-C45-146प्राणीशास्त्र (Zoology)
Histones are enriched with -

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2025-C45-147प्राणीशास्त्र (Zoology)
The first menstruation is called

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2025-C45-148प्राणीशास्त्र (Zoology)
Match List-I with List-II
List IList II
AHeartIErythropoietin
BKidneyIIAldosterone
CGastro-intestinal tractsIIIAtrial natriuretic factor
DAdrenal CortexIVSecretin

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2025-C45-156प्राणीशास्त्र (Zoology)
After maturation, in primary lymphoid organs, the lymphocytes migrate for interaction with antigens to secondary lymphoid organ(s)/tissue(s) like: A. thymus B. bone marrow C. spleen D. lymph nodes E. Peyer's patches. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2025-C45-158प्राणीशास्त्र (Zoology)
What is the main function of the spindle fibers during mitosis?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2025-C45-160प्राणीशास्त्र (Zoology)
Consider the following statements regarding function of adrenal medullary hormones: A. It causes pupilary constriction B. It is a hyperglycemic hormone C. It causes piloerection D. It increases/strength of heart contraction. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2025-C45-161प्राणीशास्त्र (Zoology)
Why can't insulin be given orally to diabetic patients?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2025-C45-163प्राणीशास्त्र (Zoology)
Who proposed that the genetic code for amino acids should be made up of three nucleotides?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2025-C45-165प्राणीशास्त्र (Zoology)
Which of the following hormones released from the pituitary is actually synthesized in the hypothalamus?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2025-C45-166प्राणीशास्त्र (Zoology)
Role of the water vascular system in Echinoderms is: A. Respiration and Locomotion B. Excretion and Locomotion C. Capture and transport of food D. Digestion and Respiration E. Digestion and Excretion. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2025-C45-167प्राणीशास्त्र (Zoology)
Which of the following type of immunity is present at the time of birth and is a non-specific type of defence in the human body?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2025-C45-169प्राणीशास्त्र (Zoology)
In frog, the Renal portal system is a special venous connection that acts to link

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2025-C45-170प्राणीशास्त्र (Zoology)
Given below are two statements: Statement I: In ecosystem, there is unidirectional flow of energy of sun from producers to consumers. Statement II: Ecosystems are exempted from 2nd law of thermodynamics. In the light of the above statements, choose the most appropriate answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2025-C45-172प्राणीशास्त्र (Zoology)
Which of the following enzyme(s) are NOT essential for gene cloning? A. Restriction enzymes B. DNA ligase C. DNA mutase D. DNA recombinase E. DNA polymerase. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2025-C45-174प्राणीशास्त्र (Zoology)
Which factor is important for termination of transcription?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2025-C45-175प्राणीशास्त्र (Zoology)
Frogs respire in water by skin and buccal cavity and on land by skin, buccal cavity and lungs. Choose the correct answer from the following

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2025-C45-176प्राणीशास्त्र (Zoology)
Twins are born to a family that lives next door to you. The twins are a boy and a girl. Which of the following must be true?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2025-C45-178प्राणीशास्त्र (Zoology)
Match List-I with List-II
List IList II
AProgesteroneIPars intermedia
BRelaxinIIOvary
CMelanocyte stimulating hormoneIIIAdrenal Medulla
DCatecholaminesIVCorpus luteum

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2025-C45-180प्राणीशास्त्र (Zoology)
Which one of the following equations represents the Verhulst-Pearl Logistic Growth of population?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2026-C11-093प्राणीशास्त्र (Zoology)
In the lac operon, the z gene codes for

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2026-C11-095प्राणीशास्त्र (Zoology)
Match List I with List II
List IList II
AGenetically modified organismIAgrobacterium tumefaciens
BThermostable DNA polymeraseIIBt cotton
CTi plasmidIIIThermus aquaticus
DpBR322IVEscherichia coli

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2026-C11-097प्राणीशास्त्र (Zoology)
Since the origin and diversification of life on Earth, there have been five episodes of mass extinction of species. How is the sixth extinction, which is in progress, different from the previous episodes?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2026-C11-098प्राणीशास्त्र (Zoology)
Alpha-helix is found in which level of protein structure?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2026-C11-100प्राणीशास्त्र (Zoology)
Identify the correct sequence of steps in each cycle of Polymerase Chain Reaction

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2026-C11-101प्राणीशास्त्र (Zoology)
Match List I with List II
List I (Phase of cell cycle)List II (Activity)
AG1 phaseIActual cell division occurs
BS phaseIICell is metabolically active and continuously grows but does not replicate its DNA
CG2 PhaseIIISynthesis of DNA occurs and the amount of DNA per cell doubles
DM phaseIVProteins are synthesized while cell growth continues

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2026-C11-103प्राणीशास्त्र (Zoology)
Which of the following statements are correct with reference to a transcription unit? A. A transcription unit in DNA is defined primarily by three regions: promoter, structural gene and terminator. B. The promoter is said to be located towards the 5'-end of the structural gene. C. The promoter is a DNA sequence that provides binding site for RNA polymerase. D. The promoter defines the template and coding strands. E. The terminator is located towards the 3'-end of the coding strand and it defines the end of the process of transcription. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2026-C11-106प्राणीशास्त्र (Zoology)
Which one of the following is the site for active ribosomal RNA synthesis?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2026-C11-108प्राणीशास्त्र (Zoology)
Match List I with List II
List IList II
AIncomplete dominanceIHuman skin colour
BCo-dominanceIIInheritance of flower colour in Antirrhinum sp.
CPleiotropyIIIPhenylketonuria disease in humans
DPolygenic inheritanceIVABO blood groups

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2026-C11-109प्राणीशास्त्र (Zoology)
Arrange the following steps of DNA fingerprinting in a correct sequence: A. Isolation of DNA and its digestion by restriction endonucleases. B. Hybridisation using a labelled VNTR probe. C. Transferring of separated DNA fragments to synthetic membranes. D. Detection of hybridised DNA fragments by autoradiography. E. Separation of DNA fragments by electrophoresis. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2026-C11-110प्राणीशास्त्र (Zoology)
Which of the following statements are correct with reference to packaging of DNA helix? A. Histones are organized to form a unit of eight molecules called histone octamer. B. Histones are negatively charged basic proteins. C. Histones are rich in the basic amino acid residues - lysine and arginine. D. The positively charged DNA is wrapped around the histone octamer to form nucleosome. E. The packaging of chromatin at higher levels requires an additional set of proteins called non-histone chromosomal proteins. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2026-C11-120प्राणीशास्त्र (Zoology)
Which of the following statements are not true regarding restriction endonucleases? A. They are called molecular scissors. B. These are the enzymes responsible for restricting the growth of bacteriophages in E. coli. C. They cut the DNA only at the centre of the palindromic sites. D. They remove nucleotides only from the ends of DNA fragments. E. They recognise specific palindromic base-pair sequences. Choose the answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2026-C11-123प्राणीशास्त्र (Zoology)
Identify the correct statements about biomolecules. A. Lipids are generally water soluble. B. Proteins are polypeptides. C. Polysaccharides are long chains of sugars. D. Adenine and guanine are substituted pyrimidines. E. Almost all enzymes are proteins. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2026-C11-124प्राणीशास्त्र (Zoology)
Which of the following statements are true with reference to the sex-determination in honeybees? A. An offspring formed from the union of a sperm and an egg, develops as a female (queen or worker). B. An unfertilized egg develops as a male by parthenogenesis. C. A male has half the number of chromosomes than that of a female. D. Males produce sperms by meiosis. E. Honeybees have a haplodiploid sex-determination system. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2026-C11-126प्राणीशास्त्र (Zoology)
Which of the following statements are correct regarding amino acids? A. They are substituted methanes. B. Serine is an aromatic amino acid. C. Valine is a neutral amino acid. D. Lysine is an acidic amino acid. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2026-C11-128प्राणीशास्त्र (Zoology)
Match List I with List II
List I (Process)List II (Location)
AGlycolysisIInner mitochondrial membrane
BETSIIMitochondrial matrix
CAccumulation of protonsIIICytoplasm
DKrebs' cycleIVIntermembrane space

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2026-C11-133प्राणीशास्त्र (Zoology)
Match List I with List II
List IList II
ATrypsinIIntercellular ground substance
BMorphineIILectin
CConcanavalin AIIIEnzyme
DCollagenIVAlkaloid

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2026-C11-135प्राणीशास्त्र (Zoology)
Which one of the following disorders is caused by the substitution of Glutamic acid (Glu) by Valine (Val) at the sixth position of the beta globin chain of the haemoglobin molecule?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2026-C11-136प्राणीशास्त्र (Zoology)
Match List I with List II
List IList II
ACortisolIStimulates the formation of alveoli in mammary glands
BAldosteroneIIProduces anti-inflammatory reactions
CCholecystokininIIIStimulates reabsorption of Na+ and water from renal tubule
DProgesteroneIVStimulates secretion of pancreatic enzymes and bile juice

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2026-C11-137प्राणीशास्त्र (Zoology)
Arrange the following events occurring in Renin-Angiotensin mechanism in the correct order: A. Increase in blood pressure and Glomerular filtration rate. B. Reabsorption of Na+ and water from distal parts of tubule due to Aldosterone. C. Fall in Glomerular filtration rate. D. Vasoconstriction by Angiotensin II and release of Aldosterone. E. Renin converts Angiotensinogen into Angiotensin I, followed by Angiotensin II. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2026-C11-138प्राणीशास्त्र (Zoology)
In humans, respiration occurs in the following steps. Arrange these steps in the correct order. A. Diffusion of O2 and CO2 between blood and tissues. B. Diffusion of O2 and CO2 across alveolar membrane. C. Pulmonary ventilation by which atmospheric air is drawn in and CO2 rich alveolar air is released out. D. Cellular respiration. E. Transport of gases by the blood. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2026-C11-140प्राणीशास्त्र (Zoology)
Insertion of a foreign DNA at BamHI site in an E.coli cloning vector pBR322 results in the loss of antibiotic resistance towards

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2026-C11-141प्राणीशास्त्र (Zoology)
The following reaction depicts the activity of a particular class of enzymes : substituents X and Y on adjacent carbons of a C–C single bond (substrate) are converted by enzyme E into X–Y (product) and C≡C (product). Identify the enzyme class 'E' from the following options

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2026-C11-142प्राणीशास्त्र (Zoology)
The specific receptors for neurotransmitters in a synapse are present on ___________.

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2026-C11-143प्राणीशास्त्र (Zoology)
What is the probability of having children with 'O' blood group, where both mother and father are heterozygous for 'A' and 'B' blood group, respectively?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2026-C11-144प्राणीशास्त्र (Zoology)
Match List I with List II
List I (Respiratory Volume)List II (Capacity in mL)
AERV (Expiratory Reserve Volume)I2500-3000 mL
BRV (Residual Volume)II500 mL
CIRV (Inspiratory Reserve Volume)III1000-1100 mL
DTV (Tidal Volume)IV1100-1200 mL

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2026-C11-146प्राणीशास्त्र (Zoology)
Male frogs can be distinguished from female frogs due to the presence of: A. Bulging eyes. B. Vocal sacs. C. Webbed digits in feet. D. Copulatory pad on first digit of fore limbs. E. Olive green-coloured skin with dark irregular spots. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2026-C11-147प्राणीशास्त्र (Zoology)
A group of researchers procured some fish like animals and upon investigation the following characters were observed: A. Endoskeleton was made of cartilage. B. Ectoparasitic; as they were found attached on fish skin with their circular sucking mouth. C. Paired fins and scales were absent, but 7 pairs of gill slits were present. Which of the following species of animals did they consider to fit best with these characters?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2026-C11-148प्राणीशास्त्र (Zoology)
Match List I with List II with respect to chronology of evolution of life forms
List IList II
AAbout 65 myaIJawless fish probably evolved
BAbout 500 myaIIThe dinosaurs suddenly disappeared from the earth
CAbout 350 myaIIISeaweeds and few plants probably existed
DAbout 320 myaIVInvertebrates were formed and became active

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2026-C11-149प्राणीशास्त्र (Zoology)
Match List I and List II
List IList II
AProgestasertIBarrier made of rubber used by females
BMultiload 375IIOral contraceptive
CDiaphragmIIIHormone releasing IUD
DSaheliIVCopper releasing IUD

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2026-C11-150प्राणीशास्त्र (Zoology)
The WBC count of a person's blood sample is 8000/cu mm. How many eosinophils and lymphocytes would be in the same blood sample approximately?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2026-C11-151प्राणीशास्त्र (Zoology)
Match List I with List II
List I (Drug)List II (Effect)
ANicotineICauses sense of euphoria and increased energy
BMorphineIIStimulates adrenal gland to release catecholamines into blood circulation
CHeroinIIIEffective sedative and painkiller
DCocaineIVA depressant; slows down body function

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2026-C11-153प्राणीशास्त्र (Zoology)
Select the set of fishes which belong to the class Osteichthyes

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2026-C11-154प्राणीशास्त्र (Zoology)
Select the incorrect statements from the following: A. Digestive system in Platyhelminthes is incomplete. B. Bilateral symmetry is a characteristic feature of adult Echinoderms. C. Pseudocoelom is possessed by Aschelminthes. D. Notochord is persistent throughout life in the class Chondrichthyes. E. Members of class Reptilia maintain a constant body temperature. Choose the answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2026-C11-156प्राणीशास्त्र (Zoology)
Which of the following equations depicts Verhulst-Pearl logistic population growth?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2026-C11-157प्राणीशास्त्र (Zoology)
Select the incorrect statement with reference to Rh grouping. A. Erythroblastosis foetalis is a condition observed having foetus with Rh−ve blood and mother with Rh+ve blood. B. Rh antigen is observed on RBCs in the majority of human beings. C. Before blood transfusion, Rh group should also be matched. D. Rh incompatibility is observed when a pregnant mother is Rh−ve and the foetus is Rh+ve. E. Erythroblastosis foetalis can be avoided by administering anti-Rh antibodies to the mother immediately after the delivery of the second child. Choose the answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2026-C11-159प्राणीशास्त्र (Zoology)
Match List I with List II
List IList II
AMolluscsIPulmonary respiration only
BReptilesIIBranchial respiration
CAdult amphibiansIIICellular respiration
DAmoebaIVPulmonary and cutaneous respiration

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2026-C11-160प्राणीशास्त्र (Zoology)
The sixth mutant codon of beta globin gene causing polymerization of Haemoglobin and change in RBC shape is ______.

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2026-C11-161प्राणीशास्त्र (Zoology)
Choose the correct statements regarding muscle contraction. A. A motor neuron carries a signal sent by the Central Nervous System (CNS) to the sarcolemma of the muscle fibre. B. The neural signal generates an action potential which causes the release of Ca++ into sarcoplasm. C. Increase in Ca++ inactivates the actin for breaking cross bridges. D. Actin binds to the myosin head to form a cross bridge. E. Shortening of sarcomere takes place, by pulling actin filaments towards the centre of 'A' band. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2026-C11-162प्राणीशास्त्र (Zoology)
Which of the following statements are correct with reference to human endoskeleton? A. Human skull is monocondylic. B. The joint between any two adjoining vertebrae is a cartilaginous joint. C. In human beings, the number of cervical vertebrae is seven. D. All ribs except the last 2 pairs are bicephalic. E. The occipital bone of skull is articulated with atlas vertebra. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2026-C11-163प्राणीशास्त्र (Zoology)
Spermatogonia undergo a series of cell divisions statements to produce sperms. Select the correct from the following: A. Spermatogonia always undergo meiotic cell division. B. Primary spermatocytes divide mitotically to produce secondary spermatocytes. C. Secondary spermatocytes, through their second meiotic division, produce haploid spermatids. D. Spermatids produce spermatozoa through mitosis. E. Spermatids transform into spermatozoa by spermiogenesis. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2026-C11-164प्राणीशास्त्र (Zoology)
The JGA (Juxta Glomerular Apparatus) is a special sensitive region formed by cellular modifications in ________ related to the same nephron.

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2026-C11-165प्राणीशास्त्र (Zoology)
Which one of the following is an appropriate example of sexual deceit?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2026-C11-166प्राणीशास्त्र (Zoology)
Choose the correct statements regarding frog's anatomy: A. Hepatic portal system is the special venous connection between liver and intestine. B. There are twelve pairs of cranial nerves arising from the brain. C. The ureters and oviducts open separately into the cloaca in female frogs. D. Hind-brain consists of cerebellum, medulla oblongata and optic lobes. E. Sinus venosus joins the right atrium of heart. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2026-C11-167प्राणीशास्त्र (Zoology)
Match List I with List II related to embryonic development at various months of pregnancy
List IList II
AThe foetus movement starts and hair appears on the headI24 weeks of pregnancy
BThe foetus develops limbs and digitsII20 weeks of pregnancy
CThe foetus develops external genital organsIII8 weeks of pregnancy
DThe foetus body is covered with fine hair; eyelids separate and eyelashes are formedIV12 weeks of pregnancy

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2026-C11-168प्राणीशास्त्र (Zoology)
In a population of a grasshopper species, the chromosome number of some members is 23 and some other members possess 24 chromosomes. The 23 and 24 chromosome-bearing members in this species are ________.

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2026-C11-169प्राणीशास्त्र (Zoology)
In which animal do haploid cells divide mitotically to produce gametes?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2026-C11-170प्राणीशास्त्र (Zoology)
Arrange the following cell layers/structures around the female gamete, from outer to inner side: A. Zona pellucida, B. Perivitelline space, C. Corona radiata, D. Plasma membrane of ovum. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2026-C11-171प्राणीशास्त्र (Zoology)
What is the reason behind production of large holes in 'Swiss Cheese'?

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2026-C11-173प्राणीशास्त्र (Zoology)
Ecological pyramids represent the relationship between the organisms at different trophic levels and they are generally inverted for

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2026-C11-174प्राणीशास्त्र (Zoology)
Choose the correct statement regarding GIFT to overcome infertility.

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2026-C11-177प्राणीशास्त्र (Zoology)
Match List I with List II related to muscular/skeletal system
List IList II
ATetanyIInflammation of joints
BArthritisIIAutoimmune disorder affecting neuromuscular junction
CMyasthenia gravisIIIWild contraction in muscle due to low Ca++ in body fluid
DMuscular dystrophyIVProgressive degeneration of skeletal muscle

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2026-C11-178प्राणीशास्त्र (Zoology)
Evolution of human appears parallel to the progressive development of brain and language skills. As such, the evolution of individual species in the sequence of their appearance is

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2026-C11-179प्राणीशास्त्र (Zoology)
The flightless bird with forelimbs modified as paddle-like structures suited for swimming is known as

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा
ZOO · BIO-2026-C11-180प्राणीशास्त्र (Zoology)
Choose the correct statements regarding population interactions between two species. A. In both parasitism and commensalism, only one species benefits and the other species is harmed. B. Both species benefit in mutualism. C. Both species benefit in commensalism. D. In parasitism, only one species benefits and the other is harmed. E. In amensalism, one species is harmed and the other is unaffected. Choose the correct answer from the options given below

हा PYQ प्रश्न पाहण्यासाठी साइन इन करा

पाहण्यासाठी लॉग इन करा