NEET Practice
← सभी प्रश्न
OMR-शैली अभ्यास · NEET UG

BIO-2023-CG3-191

BOT · BIO-2023-CG3-191वनस्पति विज्ञान (Botany)खंड B
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5'AUCGAUCGAUCGAUCGAUCGAUCG AUCG 3'?

यह PYQ प्रश्न देखने के लिए साइन इन करें

देखने के लिए लॉग इन करें